Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27057
Trapped Gene
Fundc2 (ENSMUSG00000031198)
Vector Insertion
Chr X: 72627791 - 72632440
Public Clones CMHD-GT_545F9-5S (cmhd) CMHD-GT_545F9-3 (cmhd)
Private Clones OST75527 (lexicon) OST59478 (lexicon) OST36677 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000425823 (ChrX:72627768..72627790 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGGCCGCTAACAGTCAAG ChrX:72627771..72627790 60.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000425823 (ChrX:72627768..72627790 +)
Downstram Exon
ENSMUSE00000362065 (ChrX:72632441..72632591 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGGCCGCTAACAGTCAAG ChrX:72627771..72627790 60.27 50 CTGCAAGATCCAGTGCTTCA ChrX:72632482..72632501 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000425823 ChrX:72627768..72627790 AATGGCCGCTAACAGTCAAG ChrX:72627771..72627790 60.27 50

*** Putative Vector Insertion (Chr X: 72627791 - 72632440) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000362065 ChrX:72632441..72632591 CTGCAAGATCCAGTGCTTCA ChrX:72632482..72632501 60.14 50
downstream ENSMUSE00000465895 ChrX:72636123..72636198 AGCTGTTGCAGCCAATTTTC ChrX:72636174..72636193 60.4 45
downstream ENSMUSE00000207194 ChrX:72636979..72637110 CCTCAGCTTTGCTCTTGACC ChrX:72637111..72637130 60.13 55
downstream ENSMUSE00000353252 ChrX:72639649..72640087 AAGACCTTGCACCAGGAGAA ChrX:72639897..72639916 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCATTTTAATCGCCTTGCAG ChrX:72627835..72627856 60.21 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATTTCGTGACTGGGAAAA ChrX:72630836..72630856 59.1 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031198