Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27072
Trapped Gene
Hiat1 (ENSMUSG00000027958)
Vector Insertion
Chr 3: 116337919 - 116339195
Public Clones not available
Private Clones OST73250 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000324072 (Chr3:116339196..116339308 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATATTGCAGCTGGCATGGTA Chr3:116339217..116339236 59.17 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000324072 (Chr3:116339196..116339308 -)
Downstram Exon
ENSMUSE00000324063 (Chr3:116337821..116337918 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATATTGCAGCTGGCATGGTA Chr3:116339217..116339236 59.17 45 TCAGCAGTCCGTGAAACAAG Chr3:116337813..116337832 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000357219 Chr3:116365313..116365595 TAAAATGACCCAGGGGAAGA Chr3:116365381..116365400 59.36 45
upstream ENSMUSE00000324136 Chr3:116354322..116354417 TTGCTTGGGGACTACTGACA Chr3:116354337..116354356 59.29 50
upstream ENSMUSE00000324123 Chr3:116351437..116351499 TTGCATGAAACCTTCCCTAAA Chr3:116351476..116351496 59.57 38.1
upstream ENSMUSE00000324115 Chr3:116350700..116350827 TTTTCACGTGTGCCCCTATT Chr3:116350723..116350742 60.37 45
upstream ENSMUSE00000324106 Chr3:116348284..116348398 GTTTCTGGGGTTTTTGCAGT Chr3:116348357..116348376 59.08 45
upstream ENSMUSE00000324096 Chr3:116344628..116344846 ATGGGGACAGCTTAGTGGTG Chr3:116344760..116344779 59.99 55
upstream ENSMUSE00000174661 Chr3:116344165..116344278 AAGTGGGCCAAGACTCCATA Chr3:116344249..116344268 59.55 50
upstream ENSMUSE00000324082 Chr3:116343305..116343376 AGCAGTCCTTGGCATTCTGT Chr3:116343319..116343338 59.87 50
upstream ENSMUSE00000324072 Chr3:116339196..116339308 ATATTGCAGCTGGCATGGTA Chr3:116339217..116339236 59.17 45

*** Putative Vector Insertion (Chr 3: 116337919 - 116339195) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000324063 Chr3:116337821..116337918 TCAGCAGTCCGTGAAACAAG Chr3:116337813..116337832 60.03 50
downstream ENSMUSE00000174660 Chr3:116336640..116336803 CCAGGTCTGTCCCTGTGATT Chr3:116336653..116336672 59.96 55
downstream ENSMUSE00000401167 Chr3:116334105..116335398 ACGAGCAGGTAAAGGCTCAA Chr3:116334853..116334872 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAAGTTTAATCGCCTTGC Chr3:116339132..116339152 60.21 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGTTCGTGACTGGGAAA Chr3:116339131..116339151 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027958