Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27073
Trapped Gene
Rfwd2 (ENSMUSG00000040782)
Vector Insertion
Chr 1: 161272983 - 161274951
Public Clones not available
Private Clones OST73200 (lexicon)
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000658920 (Chr1:161272938..161272982 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTAACAGCCAGGGTACAA Chr1:161272958..161272977 59.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000658920 (Chr1:161272938..161272982 +)
Downstram Exon
ENSMUSE00000688685 (Chr1:161274952..161277711 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTAACAGCCAGGGTACAA Chr1:161272958..161272977 59.34 50 GGTGGCGAATTCTCTGGATA Chr1:161275148..161275167 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000536883 Chr1:161162457..161162981 TTTGTAACGGGCTCCTCAAC Chr1:161162930..161162949 60.11 50
upstream ENSMUSE00000594714 Chr1:161169693..161169752 No primer for this exon
upstream ENSMUSE00000407886 Chr1:161174720..161174817 No primer for this exon
upstream ENSMUSE00000518026 Chr1:161179333..161179409 No primer for this exon
upstream ENSMUSE00000492186 Chr1:161180154..161180273 ATTTGGCCAATGTCAACCTC Chr1:161180212..161180231 59.8 45
upstream ENSMUSE00000228940 Chr1:161182679..161182747 CCTCAAGGTTGCAAGGAGAA Chr1:161182717..161182736 60.37 50
upstream ENSMUSE00000228933 Chr1:161196888..161196947 ATTGGAGCAGATCCAGAAGG Chr1:161196890..161196909 59.24 50
upstream ENSMUSE00000228926 Chr1:161198240..161198316 TTTGAAGCTCCTTCTCCATCA Chr1:161198291..161198311 59.94 42.86
upstream ENSMUSE00000228920 Chr1:161208220..161208277 CAACCTCCAGGTTTCAGTGG Chr1:161208248..161208267 60.54 55
upstream ENSMUSE00000228909 Chr1:161214679..161214793 GCATCAAGACGAAAGCGACT Chr1:161214712..161214731 60.55 50
upstream ENSMUSE00000228905 Chr1:161219036..161219171 GTAAGACCGTTGGCCACATT Chr1:161219107..161219126 59.86 50
upstream ENSMUSE00000228899 Chr1:161236704..161236847 GTTTGACCGGGATTGTGACT Chr1:161236710..161236729 59.83 50
upstream ENSMUSE00000228893 Chr1:161238541..161238649 GGATTCACAGGACAGAGGTCA Chr1:161238617..161238637 60.1 52.38
upstream ENSMUSE00000228887 Chr1:161239014..161239095 CTGGCTTCAGGTTCTGATGA Chr1:161239068..161239087 58.96 50
upstream ENSMUSE00000228881 Chr1:161249855..161249971 AGGCTAACGTGTGCTGTGTG Chr1:161249906..161249925 59.97 55
upstream ENSMUSE00000228874 Chr1:161255048..161255165 AAGGGACACCGAAAAGCAGT Chr1:161255104..161255123 61.05 50
upstream ENSMUSE00000228870 Chr1:161257208..161257332 TTGTAGGCCTTGCTTCCAAT Chr1:161257294..161257313 59.71 45
upstream ENSMUSE00000228866 Chr1:161258733..161258893 TTGTCAGTGCTGTGTGTTGG Chr1:161258856..161258875 59.32 50
upstream ENSMUSE00000658920 Chr1:161272938..161272982 TGCTAACAGCCAGGGTACAA Chr1:161272958..161272977 59.34 50

*** Putative Vector Insertion (Chr 1: 161272983 - 161274951) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000688685 Chr1:161274952..161277711 GGTGGCGAATTCTCTGGATA Chr1:161275148..161275167 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTAACAGCCAGGGTACAA Chr1:161272959..161272979 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTAACAGCCAGGGTACAA Chr1:161272959..161272979 59.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040782