Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27084
Trapped Gene
Smad3 (ENSMUSG00000032402)
Vector Insertion
Chr 9: 63515730 - 63598856
Public Clones not available
Private Clones OST72715 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697488 (Chr9:63598857..63598882 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697488 (Chr9:63598857..63598882 -)
Downstram Exon
ENSMUSE00000532966 (Chr9:63515536..63515729 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACAGGCGGCAGTAGATAACG Chr9:63515640..63515659 60.29 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000340880 Chr9:63605279..63605801 AGGAGAAGTGGTGCGAGAAG Chr9:63605386..63605405 59.6 55
upstream ENSMUSE00000712288 Chr9:63605279..63605801 AGGAGAAGTGGTGCGAGAAG Chr9:63605386..63605405 59.6 55
upstream ENSMUSE00000697488 Chr9:63598857..63598882 No primer for this exon

*** Putative Vector Insertion (Chr 9: 63515730 - 63598856) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000532966 Chr9:63515536..63515729 ACAGGCGGCAGTAGATAACG Chr9:63515640..63515659 60.29 55
downstream ENSMUSE00000219453 Chr9:63515282..63515413 GTGTTCTCGGGAATGGAATG Chr9:63515301..63515320 60.32 50
downstream ENSMUSE00000712376 Chr9:63513955..63514029 CACTCAGGTAGCCAGGAGGT Chr9:63513981..63514000 59.33 60
downstream ENSMUSE00000713151 Chr9:63513955..63514029 CACTCAGGTAGCCAGGAGGT Chr9:63513981..63514000 59.33 60
downstream ENSMUSE00000219449 Chr9:63511472..63511522 GTTATTGTGTGCTGGGGACA Chr9:63511454..63511473 59.42 50
downstream ENSMUSE00000697486 Chr9:63511472..63511522 GTTATTGTGTGCTGGGGACA Chr9:63511454..63511473 59.42 50
downstream ENSMUSE00000219450 Chr9:63503358..63503570 GTAAGTTCCACGGCTGCATT Chr9:63503350..63503369 60.14 50
downstream ENSMUSE00000697485 Chr9:63503358..63503570 GTAAGTTCCACGGCTGCATT Chr9:63503350..63503369 60.14 50
downstream ENSMUSE00000532955 Chr9:63502493..63502630 GTTGGGAGACTGGACGAAAA Chr9:63502523..63502542 60.09 50
downstream ENSMUSE00000697484 Chr9:63502493..63502630 GTTGGGAGACTGGACGAAAA Chr9:63502523..63502542 60.09 50
downstream ENSMUSE00000219446 Chr9:63500288..63500432 CAGCCTTTGACGAAGCTCAT Chr9:63500281..63500300 60.54 50
downstream ENSMUSE00000697483 Chr9:63500288..63500432 CAGCCTTTGACGAAGCTCAT Chr9:63500281..63500300 60.54 50
downstream ENSMUSE00000697482 Chr9:63497478..63498192 TGGCGATACACCACCTGTTA Chr9:63497786..63497805 59.99 50
downstream ENSMUSE00000361634 Chr9:63494574..63498192 TGGCGATACACCACCTGTTA Chr9:63497786..63497805 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGTGTCACCCAGAAGACG Chr9:63553863..63553883 59.86 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGTGTCACCCAGAAGACG Chr9:63553863..63553883 59.86 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032402