Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27089
Trapped Gene
Grtp1 (ENSMUSG00000038515)
Vector Insertion
Chr 8: 13189748 - 13192049
Public Clones IST10098H1 (tigm)
Private Clones OST72003 (lexicon) OST63641 (lexicon) OST45724 (lexicon) OST32294 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273469 (Chr8:13192050..13192208 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTATGTCCGGAAGGGAATC Chr8:13192183..13192202 60.8 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273469 (Chr8:13192050..13192208 -)
Downstram Exon
ENSMUSE00000273458 (Chr8:13189623..13189747 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTATGTCCGGAAGGGAATC Chr8:13192183..13192202 60.8 55 CGAAACATCACGTTGTCAGG Chr8:13189689..13189708 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514028 Chr8:13200481..13200620 GCTGCAGAGGTTGTGAGTCC Chr8:13200551..13200570 61.02 60
upstream ENSMUSE00000273480 Chr8:13200049..13200200 ATCGATCCGTATGGGTTTGA Chr8:13200180..13200199 60.15 45
upstream ENSMUSE00000273469 Chr8:13192050..13192208 GCTATGTCCGGAAGGGAATC Chr8:13192183..13192202 60.8 55

*** Putative Vector Insertion (Chr 8: 13189748 - 13192049) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000273458 Chr8:13189623..13189747 CGAAACATCACGTTGTCAGG Chr8:13189689..13189708 60.15 50
downstream ENSMUSE00000273446 Chr8:13188510..13188560 GGAAGACCCAGGTTTCTGTG Chr8:13188512..13188531 59.55 55
downstream ENSMUSE00000273440 Chr8:13186883..13186979 CCAACAAGAGCGTCCAAAAG Chr8:13186875..13186894 60.8 50
downstream ENSMUSE00000273430 Chr8:13179583..13179755 GCCACTGCTGGTAGCTTCAT Chr8:13179649..13179668 60.43 55
downstream ENSMUSE00000273420 Chr8:13179323..13179508 GCATGAATGCGTGACACTCT Chr8:13179303..13179322 59.87 50
downstream ENSMUSE00000685645 Chr8:13175162..13177142 ATGGGACAATGTCGGGATAA Chr8:13175367..13175386 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGTGCTCAGAGCCTTGTG Chr8:13192020..13192040 62.17 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGTGCTCAGAGCCTTGTG Chr8:13192020..13192040 62.17 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCAGTGAAGCGCTATGTCC Chr8:13192192..13192212 59.03 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGTCGTGACTGGGAAAACC Chr8:13192142..13192162 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038515