Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27096
Trapped Gene
Wdr51a (ENSMUSG00000023345)
Vector Insertion
Chr 9: 106210365 - 106232203
Public Clones 5SE289G02 (ggtc)
Private Clones OST71164 (lexicon)
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634562 (Chr9:106210272..106210364 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACCCCTAACCAGCTCTTC Chr9:106210335..106210354 61.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634562 (Chr9:106210272..106210364 +)
Downstram Exon
ENSMUSE00000358598 (Chr9:106232204..106232347 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACCCCTAACCAGCTCTTC Chr9:106210335..106210354 61.01 60 ACAGGCAAATCCATTTTTGG Chr9:106232226..106232245 59.8 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583361 Chr9:106183643..106183787 AACTGAACTGGCACAACTGC Chr9:106183690..106183709 58.94 50
upstream ENSMUSE00000583360 Chr9:106185183..106185267 ATTTTAAGGGCCACCGAGAT Chr9:106185205..106185224 59.8 45
upstream ENSMUSE00000634568 Chr9:106187212..106187383 GCTCCCGAGACAAGACTGTT Chr9:106187344..106187363 59.46 55
upstream ENSMUSE00000634567 Chr9:106187724..106187903 CATCGCCAGAGATTCCTGTT Chr9:106187845..106187864 60.22 50
upstream ENSMUSE00000634566 Chr9:106189111..106189218 TCATCGTGTCTGCCAGTGAT Chr9:106189131..106189150 60.28 50
upstream ENSMUSE00000634565 Chr9:106190322..106190437 GACAACACGGTGAAGGTGTG Chr9:106190380..106190399 60.05 55
upstream ENSMUSE00000530303 Chr9:106193338..106193410 No primer for this exon
upstream ENSMUSE00000634564 Chr9:106197472..106197605 ACCCATCGGGAAACTACCTC Chr9:106197505..106197524 60.19 55
upstream ENSMUSE00000634563 Chr9:106207596..106207664 AAGAACGGGGGAGTATTTCG Chr9:106207622..106207641 60.31 50
upstream ENSMUSE00000634562 Chr9:106210272..106210364 CCACCCCTAACCAGCTCTTC Chr9:106210335..106210354 61.01 60

*** Putative Vector Insertion (Chr 9: 106210365 - 106232203) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000358598 Chr9:106232204..106232347 ACAGGCAAATCCATTTTTGG Chr9:106232226..106232245 59.8 40
downstream ENSMUSE00000583348 Chr9:106252013..106252202 TGGCGTTCTCTGCATGATTA Chr9:106252108..106252127 60.37 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTGACGTAATCGCCTTGC Chr9:106216408..106216428 62.48 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCTTCGTGACTGGGAAAA Chr9:106222410..106222430 60.64 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023345