Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27116
Trapped Gene
Mapk13 (ENSMUSG00000004864)
Vector Insertion
Chr 17: 28908162 - 28912198
Public Clones not available
Private Clones OST69707 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137142 (Chr17:28908103..28908161 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137142 (Chr17:28908103..28908161 +)
Downstram Exon
ENSMUSE00000239554 (Chr17:28912199..28912307 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000386527 Chr17:28906306..28906473 No primer for this exon
upstream ENSMUSE00000137141 Chr17:28906956..28907085 No primer for this exon
upstream ENSMUSE00000137142 Chr17:28908103..28908161 No primer for this exon

*** Putative Vector Insertion (Chr 17: 28908162 - 28912198) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000239554 Chr17:28912199..28912307 No primer for this exon
downstream ENSMUSE00000137143 Chr17:28912499..28912528 No primer for this exon
downstream ENSMUSE00000137148 Chr17:28913080..28913127 No primer for this exon
downstream ENSMUSE00000137137 Chr17:28913247..28913361 No primer for this exon
downstream ENSMUSE00000137139 Chr17:28913447..28913518 No primer for this exon
downstream ENSMUSE00000137147 Chr17:28914427..28914506 No primer for this exon
downstream ENSMUSE00000137145 Chr17:28914668..28914746 No primer for this exon
downstream ENSMUSE00000137138 Chr17:28915022..28915198 No primer for this exon
downstream ENSMUSE00000239380 Chr17:28915373..28915647 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCATGTAATCGCCTTGCAG Chr17:28908207..28908227 59.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTCAACTCCTGTCTTCCT Chr17:28908188..28908209 59.87 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004864