Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27121
Trapped Gene
Nrip1 (ENSMUSG00000048490)
Vector Insertion
Chr 16: 76352795 - 76373116
Public Clones IST14458E1 (tigm) IST12819H2 (tigm) IST15001G8 (tigm) IST14140H6 (tigm)
IST14209G8 (tigm) IST13568A6 (tigm) IST14116E11 (tigm)
Private Clones OST69164 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000406006 (Chr16:76373117..76373294 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGGCTAACCTGGGAAGGAG Chr16:76373158..76373177 62.76 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000406006 (Chr16:76373117..76373294 -)
Downstram Exon
ENSMUSE00000357001 (Chr16:76352717..76352794 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGGCTAACCTGGGAAGGAG Chr16:76373158..76373177 62.76 60 TCCTCCCGAATGTTAAAGGA Chr16:76352708..76352727 59.5 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000719562 Chr16:76374015..76374072 AGGGAGCTAGCTGTGCACTC Chr16:76374020..76374039 59.78 60
upstream ENSMUSE00000406006 Chr16:76373117..76373294 ACGGCTAACCTGGGAAGGAG Chr16:76373158..76373177 62.76 60

*** Putative Vector Insertion (Chr 16: 76352795 - 76373116) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000357001 Chr16:76352717..76352794 TCCTCCCGAATGTTAAAGGA Chr16:76352708..76352727 59.5 45
downstream ENSMUSE00000719682 Chr16:76352717..76352791 TCCTCCCGAATGTTAAAGGA Chr16:76352708..76352727 59.5 45
downstream ENSMUSE00000389637 Chr16:76330991..76331109 GGAAGCTGAGAAGGCTGTTG Chr16:76331005..76331024 60.13 55
downstream ENSMUSE00000348925 Chr16:76291107..76295260 GTTGTGGGTCTGGAAGTCGT Chr16:76292587..76292606 60.01 55
downstream ENSMUSE00000714196 Chr16:76287645..76295260 ACTGTCGTGTTGGATGACCA Chr16:76288363..76288382 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGTGAAGTTAAGCACACA Chr16:76358084..76358104 58.62 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGTGAAGTTAAGCACACA Chr16:76358084..76358104 58.62 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGTCAGCCTCGCAGACATTG Chr16:76358285..76358305 61.57 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGTCAGCCTCGCAGACATTG Chr16:76358285..76358305 61.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048490