Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27126
Trapped Gene
Sf3b2 (ENSMUSG00000024853)
Vector Insertion
Chr 19: 5274528 - 5274791
Public Clones not available
Private Clones OST69021 (lexicon) OST67450 (lexicon)
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000145531 (Chr19:5274792..5274977 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGTACGAGGAGCACGTTCG Chr19:5274862..5274881 60.45 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000145531 (Chr19:5274792..5274977 -)
Downstram Exon
ENSMUSE00000339566 (Chr19:5273935..5274527 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGTACGAGGAGCACGTTCG Chr19:5274862..5274881 60.45 55 AGCTATGCGAGCAGGACCTA Chr19:5274417..5274436 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000145518 Chr19:5295262..5295411 GCCAGATTGGCAGAGATAGG Chr19:5295276..5295295 59.8 55
upstream ENSMUSE00000145520 Chr19:5295041..5295087 No primer for this exon
upstream ENSMUSE00000145508 Chr19:5294299..5294376 GGAGAAGATGGGGACAAAGC Chr19:5294324..5294343 60.97 55
upstream ENSMUSE00000390819 Chr19:5293080..5293319 GGCGCTGTCAGAAGAAGAAC Chr19:5293142..5293161 60.14 55
upstream ENSMUSE00000351909 Chr19:5291305..5291422 CTGGGTGTCCGTACTCCTCT Chr19:5291316..5291335 59.17 60
upstream ENSMUSE00000256474 Chr19:5288304..5288413 CTCCAGTAGGCCCTGTGGTT Chr19:5288388..5288407 61.46 60
upstream ENSMUSE00000145505 Chr19:5287910..5288006 CCCAGGCTTTGGAAAAGATT Chr19:5287956..5287975 60.42 45
upstream ENSMUSE00000145517 Chr19:5287535..5287626 TCTGGGACAGTCAGCATCAG Chr19:5287573..5287592 59.98 55
upstream ENSMUSE00000360179 Chr19:5287069..5287284 TCGGAACCGAAAGAAGAAGA Chr19:5287251..5287270 59.93 45
upstream ENSMUSE00000361123 Chr19:5286811..5286948 CTTTGAGGAGGAGCACAAGG Chr19:5286843..5286862 59.98 55
upstream ENSMUSE00000405373 Chr19:5286577..5286657 CGCCGAATGAATCGTTTTAC Chr19:5286596..5286615 60.46 45
upstream ENSMUSE00000392017 Chr19:5286189..5286416 GTGGAGATGCATGACGTGAC Chr19:5286376..5286395 60.13 55
upstream ENSMUSE00000145534 Chr19:5284575..5284724 ATGGGGAAGATCGACATTGA Chr19:5284654..5284673 60.28 45
upstream ENSMUSE00000145536 Chr19:5283858..5283947 ACACGGCTGAAGGAGAAGAA Chr19:5283913..5283932 59.99 50
upstream ENSMUSE00000145544 Chr19:5283643..5283750 CCTGAAAATCCCTGGACTGA Chr19:5283660..5283679 60.04 50
upstream ENSMUSE00000145540 Chr19:5279842..5279949 CTCTATGGGGACGTGTTTGG Chr19:5279864..5279883 60.37 55
upstream ENSMUSE00000145529 Chr19:5279470..5279612 GGAGGAAAGCGATGAAGACA Chr19:5279507..5279526 60.34 50
upstream ENSMUSE00000145542 Chr19:5279269..5279370 ACTCCCGGAGGATTCTCATC Chr19:5279341..5279360 60.42 55
upstream ENSMUSE00000145538 Chr19:5275064..5275163 ATGGGATCCACCCACATTTA Chr19:5275077..5275096 59.87 45
upstream ENSMUSE00000145531 Chr19:5274792..5274977 AAGTACGAGGAGCACGTTCG Chr19:5274862..5274881 60.45 55

*** Putative Vector Insertion (Chr 19: 5274528 - 5274791) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000339566 Chr19:5273935..5274527 AGCTATGCGAGCAGGACCTA Chr19:5274417..5274436 60.14 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAAGCAGAAGGTGGGAGCAA Chr19:5274780..5274800 60.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAGCAGAAGGTGGGAGCAA Chr19:5274780..5274800 60.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024853