Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27137
Trapped Gene
Odz3 (ENSMUSG00000031561)
Vector Insertion
Chr 8: 49760077 - 49929131
Public Clones IST15099F1 (tigm) IST13320C6 (tigm) IST10009E7 (tigm) IST12990D6 (tigm)
IST14998H6 (tigm) IST14780B12 (tigm)
Private Clones OST68836 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683597 (Chr8:49929132..49929268 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCGGAGGAGTCAAGGATT Chr8:49929205..49929224 60.74 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683597 (Chr8:49929132..49929268 -)
Downstram Exon
ENSMUSE00000683596 (Chr8:49759570..49760076 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCGGAGGAGTCAAGGATT Chr8:49929205..49929224 60.74 55 AAGCAGCCGTGAAGAATCAT Chr8:49759800..49759819 59.84 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683597 Chr8:49929132..49929268 GAGCGGAGGAGTCAAGGATT Chr8:49929205..49929224 60.74 55

*** Putative Vector Insertion (Chr 8: 49760077 - 49929131) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000473700 Chr8:49759764..49760044 AAGCAGCCGTGAAGAATCAT Chr8:49759800..49759819 59.84 45
downstream ENSMUSE00000683596 Chr8:49759570..49760076 AAGCAGCCGTGAAGAATCAT Chr8:49759800..49759819 59.84 45
downstream ENSMUSE00000494413 Chr8:49731612..49731890 ACTGTCCGACCTGTTCTCGT Chr8:49731597..49731616 59.76 55
downstream ENSMUSE00000683598 Chr8:49641232..49641393 No primer for this exon
downstream ENSMUSE00000683604 Chr8:49641069..49641200 CACCTTTCTTGCACAGCACA Chr8:49641097..49641116 61.05 50
downstream ENSMUSE00000683611 Chr8:49640507..49641047 GAAACTGCCCACCAACTGAT Chr8:49640813..49640832 59.97 50
downstream ENSMUSE00000491981 Chr8:49502362..49502599 CTGGGTTGTTTGAAGGTTGC Chr8:49502557..49502576 60.53 50
downstream ENSMUSE00000683610 Chr8:49502362..49502599 CTGGGTTGTTTGAAGGTTGC Chr8:49502557..49502576 60.53 50
downstream ENSMUSE00000683616 Chr8:49502362..49502603 GGGTTGTTTGAAGGTTGCTC Chr8:49502559..49502578 59.57 50
downstream ENSMUSE00000498613 Chr8:49480790..49481028 TACTGAACAGTGGCGTCGTC Chr8:49480960..49480979 59.9 55
downstream ENSMUSE00000712351 Chr8:49480790..49481028 TACTGAACAGTGGCGTCGTC Chr8:49480960..49480979 59.9 55
downstream ENSMUSE00000720986 Chr8:49480790..49481028 TACTGAACAGTGGCGTCGTC Chr8:49480960..49480979 59.9 55
downstream ENSMUSE00000496270 Chr8:49452665..49452787 ATTGTCGCCAGAAGGTAACG Chr8:49452644..49452663 60.13 50
downstream ENSMUSE00000517019 Chr8:49434553..49434767 CTGAGTATGGGAAGGCGGTA Chr8:49434531..49434550 60.09 55
downstream ENSMUSE00000515724 Chr8:49428586..49428796 AGGAGACCTGCTCTGGGTTT Chr8:49428582..49428601 60.25 55
downstream ENSMUSE00000521004 Chr8:49427969..49428070 TAGAAACCCGGGGAAACAAT Chr8:49427966..49427985 60.53 45
downstream ENSMUSE00000582361 Chr8:49427611..49427805 AGTATTGCCCGTTGCCACTA Chr8:49427745..49427764 60.52 50
downstream ENSMUSE00000480622 Chr8:49426308..49426508 ATGGATACACACCCCGTGAT Chr8:49426440..49426459 59.93 50
downstream ENSMUSE00000582360 Chr8:49420943..49421128 AGCCTTCTTCACAGCGACAG Chr8:49421038..49421057 60.73 55
downstream ENSMUSE00000683607 Chr8:49420107..49421128 GGGAGAAGCATTCATGGGTA Chr8:49420785..49420804 59.89 50
downstream ENSMUSE00000501367 Chr8:49398592..49398618 No primer for this exon
downstream ENSMUSE00000582359 Chr8:49395977..49396123 TCTCCATGGCTACGTCACAG Chr8:49395988..49396007 59.85 55
downstream ENSMUSE00000503811 Chr8:49386109..49386325 CACGACAGTAGGGCTGGTTT Chr8:49386232..49386251 60.17 55
downstream ENSMUSE00000265168 Chr8:49384948..49385067 CACGTTGACGCCAATAAGTG Chr8:49384979..49384998 60.17 50
downstream ENSMUSE00000582358 Chr8:49384140..49384401 GAATGGGGAACGCTCAAATA Chr8:49384319..49384338 59.9 45
downstream ENSMUSE00000265150 Chr8:49378861..49379128 GCCTCTGACAAGCCGTAGAC Chr8:49378844..49378863 60.02 60
downstream ENSMUSE00000265144 Chr8:49377473..49377616 TGTTCGAAGCATCCAACTCA Chr8:49377499..49377518 60.39 45
downstream ENSMUSE00000265138 Chr8:49373145..49373394 AGTTTGTTCCCGTCAGCTTG Chr8:49373237..49373256 60.29 50
downstream ENSMUSE00000396569 Chr8:49372487..49372507 No primer for this exon
downstream ENSMUSE00000265121 Chr8:49364312..49364544 CGATAGATTCTGCGGGTGTT Chr8:49364433..49364452 60.1 50
downstream ENSMUSE00000582357 Chr8:49363021..49363175 GGAGCCCAGGAGAGTTGATA Chr8:49363056..49363075 59.24 55
downstream ENSMUSE00000265104 Chr8:49361384..49362258 CTTTTCAGACACCCGTTGGT Chr8:49361464..49361483 60.01 50
downstream ENSMUSE00000448341 Chr8:49342186..49342361 GTCCACCGTGATAGCCTTGT Chr8:49342246..49342265 60 55
downstream ENSMUSE00000448330 Chr8:49339764..49339999 CTCACCGGGAAGAGTCATGT Chr8:49339823..49339842 60.11 55
downstream ENSMUSE00000448322 Chr8:49325599..49325895 CTTGGTGGTCCGATCAAAGT Chr8:49325826..49325845 59.97 50
downstream ENSMUSE00000448312 Chr8:49320644..49322255 TTACCCGGCCCATATTATCA Chr8:49321498..49321517 60 45
downstream ENSMUSE00000448303 Chr8:49317362..49317492 AGATGGAAGCCAAACGTCAC Chr8:49317434..49317453 60.12 50
downstream ENSMUSE00000683615 Chr8:49313059..49314555 AGAGTCCGGTTTGGATTGTG Chr8:49313724..49313743 59.97 50
downstream ENSMUSE00000607823 Chr8:49313036..49314555 AGAGTCCGGTTTGGATTGTG Chr8:49313724..49313743 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGATGTGGTTCTTGGTTTGTTT Chr8:49908109..49908131 60.13 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCCTCGTGACTGGGAAAA Chr8:49908066..49908086 60.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTTTTCCCTCACTCCCATGT Chr8:49908220..49908240 59.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTTTTCCCTCACTCCCATGT Chr8:49908220..49908240 59.38 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031561