Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27142
Trapped Gene
Hn1 (ENSMUSG00000020737)
Vector Insertion
Chr 11: 115359614 - 115361979
Public Clones IST10323C12 (tigm) IST10875H5 (tigm)
Private Clones OST68726 (lexicon) OST36059 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000646221 (Chr11:115361980..115361998 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000646221 (Chr11:115361980..115361998 -)
Downstram Exon
ENSMUSE00000257359 (Chr11:115358669..115359613 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000257397 Chr11:115375534..115375698 No primer for this exon
upstream ENSMUSE00000257388 Chr11:115364346..115364488 No primer for this exon
upstream ENSMUSE00000108845 Chr11:115363319..115363416 No primer for this exon
upstream ENSMUSE00000646221 Chr11:115361980..115361998 No primer for this exon

*** Putative Vector Insertion (Chr 11: 115359614 - 115361979) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000257359 Chr11:115358669..115359613 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGTTAATCGCCTTGCAG Chr11:115361914..115361934 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAGGTCGTGACTGGGAAA Chr11:115361915..115361935 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTGCTGTTTTAATCGCCTTG Chr11:115361937..115361957 58.96 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACAAGCTGCCTTCTGTACCC Chr11:115361955..115361975 59.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020737