Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27147
Trapped Gene
Rab6b (ENSMUSG00000032549)
Vector Insertion
Chr 9: 103014557 - 103042711
Public Clones not available
Private Clones OST68543 (lexicon) OST64133 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220692 (Chr9:103014281..103014556 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCTCCTCCTCCTCCTCCT Chr9:103014443..103014462 61.24 65 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220692 (Chr9:103014281..103014556 +)
Downstram Exon
ENSMUSE00000320561 (Chr9:103042712..103042770 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCTCCTCCTCCTCCTCCT Chr9:103014443..103014462 61.24 65 AGGTGTTGTCGAAGCTGTCA Chr9:103042768..103042787 59.47 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000220692 Chr9:103014281..103014556 CTCCTCCTCCTCCTCCTCCT Chr9:103014443..103014462 61.24 65

*** Putative Vector Insertion (Chr 9: 103014557 - 103042711) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000320561 Chr9:103042712..103042770 AGGTGTTGTCGAAGCTGTCA Chr9:103042768..103042787 59.47 50
downstream ENSMUSE00000320542 Chr9:103063150..103063203 AAGAAGTCAATCCCGATGGTT Chr9:103063174..103063194 59.82 42.86
downstream ENSMUSE00000220690 Chr9:103063394..103063499 ACCGTGGAGTCTCGGATGTA Chr9:103063476..103063495 60.53 55
downstream ENSMUSE00000220691 Chr9:103064872..103064983 GTCCTGACGTCATCAATCCA Chr9:103064923..103064942 59.48 50
downstream ENSMUSE00000220687 Chr9:103066140..103066233 TGGTCTCGATGAACATGACG Chr9:103066207..103066226 60.69 50
downstream ENSMUSE00000320466 Chr9:103069436..103069502 No primer for this exon
downstream ENSMUSE00000478381 Chr9:103083512..103087598 TTGGGATCATGCCCTAAGAG Chr9:103086302..103086321 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCTTCTGCCCTGTGTTTC Chr9:103023587..103023607 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCTTCTGCCCTGTGTTTC Chr9:103023587..103023607 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032549