Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27149
Trapped Gene
Slc35f2 (ENSMUSG00000042195)
Vector Insertion
Chr 9: 53654585 - 53655852
Public Clones E324D07 (ggtc)
Private Clones OST68481 (lexicon)
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000275352 (Chr9:53654425..53654584 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCCGGGCAAGATACAAAG Chr9:53654475..53654494 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000275352 (Chr9:53654425..53654584 +)
Downstram Exon
ENSMUSE00000275333 (Chr9:53655853..53656009 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCCGGGCAAGATACAAAG Chr9:53654475..53654494 60.21 50 TGTATGCCGCTGATGATTGT Chr9:53656009..53656028 60.1 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000534833 Chr9:53619544..53619701 ATCCGACGCAAACTCTTCAC Chr9:53619679..53619698 60.26 50
upstream ENSMUSE00000472752 Chr9:53645645..53645820 GCCATCACCAGCCAGTATTT Chr9:53645703..53645722 59.96 50
upstream ENSMUSE00000275372 Chr9:53648818..53648945 CCGATGTGGAAGCCAATTAT Chr9:53648881..53648900 59.78 45
upstream ENSMUSE00000275352 Chr9:53654425..53654584 TCTCCGGGCAAGATACAAAG Chr9:53654475..53654494 60.21 50

*** Putative Vector Insertion (Chr 9: 53654585 - 53655852) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000275333 Chr9:53655853..53656009 TGTATGCCGCTGATGATTGT Chr9:53656009..53656028 60.1 45
downstream ENSMUSE00000275310 Chr9:53657493..53657545 GAATCCGGGCAATGTCTTTA Chr9:53657530..53657549 59.9 45
downstream ENSMUSE00000275287 Chr9:53658682..53658836 GACTGAAGTGGCACTCGTGA Chr9:53658773..53658792 60.03 55
downstream ENSMUSE00000636885 Chr9:53664590..53665960 CAGAGTCTGTGGCTTGTCCA Chr9:53664802..53664821 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTGGGCGAGAAGATAATTC Chr9:53654563..53654584 59.83 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTGGGCGAGAAGATAATTC Chr9:53654563..53654584 59.83 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042195