Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27153
Trapped Gene
Paip2b (ENSMUSG00000045896)
Vector Insertion
Chr 6: 83781323 - 83781628
Public Clones not available
Private Clones OST68341 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000653661 (Chr6:83781629..83781735 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTACCTCGAGCGTTTGTG Chr6:83781705..83781724 60.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000653661 (Chr6:83781629..83781735 -)
Downstram Exon
ENSMUSE00000559040 (Chr6:83781265..83781322 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTACCTCGAGCGTTTGTG Chr6:83781705..83781724 60.31 55 CTGTGTTCAGCGTCGTCATC Chr6:83781253..83781272 60.47 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000653661 Chr6:83781629..83781735 AGGTACCTCGAGCGTTTGTG Chr6:83781705..83781724 60.31 55

*** Putative Vector Insertion (Chr 6: 83781323 - 83781628) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000559040 Chr6:83781265..83781322 CTGTGTTCAGCGTCGTCATC Chr6:83781253..83781272 60.47 55
downstream ENSMUSE00000390940 Chr6:83764716..83764863 TTCTGCAAATGGGTTTTCCT Chr6:83764733..83764752 59.55 40
downstream ENSMUSE00000350403 Chr6:83759893..83760069 GTCCTGGTCCTCTTCATCCA Chr6:83759973..83759992 60.05 55
downstream ENSMUSE00000615086 Chr6:83756056..83758886 CGGGTACAATTGTGCTTCCT Chr6:83756571..83756590 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr6:83781558..83781578 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000045896