Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27165
Trapped Gene
Hs2st1 (ENSMUSG00000040151)
Vector Insertion
Chr 3: 144128250 - 144128727
Public Clones not available
Private Clones OST68006 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000669042 (Chr3:144128728..144128752 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000669042 (Chr3:144128728..144128752 -)
Downstram Exon
ENSMUSE00000373159 (Chr3:144128011..144128249 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ATGGCGCTGTTCAATTTCTC Chr3:144128181..144128200 60.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000492150 Chr3:144232698..144233103 ATGGGGCTCCTCAGGATTAT Chr3:144232802..144232821 59.75 50
upstream ENSMUSE00000669042 Chr3:144128728..144128752 No primer for this exon

*** Putative Vector Insertion (Chr 3: 144128250 - 144128727) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000373159 Chr3:144128011..144128249 ATGGCGCTGTTCAATTTCTC Chr3:144128181..144128200 60.22 45
downstream ENSMUSE00000270714 Chr3:144116916..144117001 TTCATCTCGTTCCAGGTGGT Chr3:144116939..144116958 60.51 50
downstream ENSMUSE00000270703 Chr3:144110234..144110372 AGGGTCCCTGATGACATTGA Chr3:144110302..144110321 60.33 50
downstream ENSMUSE00000270691 Chr3:144100559..144100656 CAGAGCTTCTCTGGAGCACA Chr3:144100579..144100598 59.44 55
downstream ENSMUSE00000270681 Chr3:144098426..144098583 TCGAGCAGCATGATGAAGTC Chr3:144098454..144098473 60.1 50
downstream ENSMUSE00000478936 Chr3:144094079..144097678 GAATCCATTCGCTCCAAAAA Chr3:144094855..144094874 60.02 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000040151