Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27167
Trapped Gene
Spin1 (ENSMUSG00000021395)
Vector Insertion
Chr 13: 51239981 - 51244330
Public Clones not available
Private Clones OST67992 (lexicon)
Severity of mutation (?) Insertion after 73% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682526 (Chr13:51239977..51239980 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682526 (Chr13:51239977..51239980 +)
Downstram Exon
ENSMUSE00000642043 (Chr13:51244331..51244530 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000615586 Chr13:51196249..51196359 No primer for this exon
upstream ENSMUSE00000615585 Chr13:51218457..51218657 No primer for this exon
upstream ENSMUSE00000615584 Chr13:51223294..51223342 No primer for this exon
upstream ENSMUSE00000682533 Chr13:51229692..51229751 No primer for this exon
upstream ENSMUSE00000615582 Chr13:51229717..51229751 No primer for this exon
upstream ENSMUSE00000351341 Chr13:51234726..51234979 No primer for this exon
upstream ENSMUSE00000682531 Chr13:51234726..51234749 No primer for this exon
upstream ENSMUSE00000411462 Chr13:51234751..51234979 No primer for this exon
upstream ENSMUSE00000240748 Chr13:51239671..51239904 No primer for this exon
upstream ENSMUSE00000682528 Chr13:51239671..51239877 No primer for this exon
upstream ENSMUSE00000682526 Chr13:51239977..51239980 No primer for this exon

*** Putative Vector Insertion (Chr 13: 51239981 - 51244330) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000475082 Chr13:51244331..51247915 No primer for this exon
downstream ENSMUSE00000642043 Chr13:51244331..51244530 No primer for this exon
downstream ENSMUSE00000682524 Chr13:51245988..51246135 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTAATGTAATCGCCTTGCAG Chr13:51240024..51240046 60.15 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAATGCGTGACTGGGAAAAC Chr13:51243026..51243047 59.99 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021395