Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27169
Trapped Gene
Tarbp2 (ENSMUSG00000023051)
Vector Insertion
Chr 15: 102352228 - 102352411
Public Clones not available
Private Clones OST67928 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000133224 (Chr15:102352155..102352227 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCAGCAGTCTGAGTGCAA Chr15:102352189..102352208 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000133224 (Chr15:102352155..102352227 +)
Downstram Exon
ENSMUSE00000133218 (Chr15:102352412..102352529 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCAGCAGTCTGAGTGCAA Chr15:102352189..102352208 60.33 55 CCAGACTCTTGGGTCACCAT Chr15:102352473..102352492 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000133220 Chr15:102348890..102349033 GGAGGGAATGAGTGAAGAGG Chr15:102348974..102348993 58.66 55
upstream ENSMUSE00000133221 Chr15:102349553..102349722 ATAGGAAAGACGCCCGTGTA Chr15:102349623..102349642 59.59 50
upstream ENSMUSE00000133226 Chr15:102350906..102351008 No primer for this exon
upstream ENSMUSE00000133222 Chr15:102351552..102351644 AGGACACTCCTGTCGTTGCT Chr15:102351584..102351603 59.91 55
upstream ENSMUSE00000133224 Chr15:102352155..102352227 CCTCAGCAGTCTGAGTGCAA Chr15:102352189..102352208 60.33 55

*** Putative Vector Insertion (Chr 15: 102352228 - 102352411) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000133218 Chr15:102352412..102352529 CCAGACTCTTGGGTCACCAT Chr15:102352473..102352492 59.96 55
downstream ENSMUSE00000133225 Chr15:102352855..102352982 GTTACGCTTTGCCAGCTTTT Chr15:102352892..102352911 59.54 45
downstream ENSMUSE00000514279 Chr15:102353280..102353481 GAGCAACTGCGAAGGGATAG Chr15:102353389..102353408 59.98 55
downstream ENSMUSE00000133219 Chr15:102353616..102354105 CAGAGAGAGCAGGGTTTTGG Chr15:102354054..102354073 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCAGCAGTCTGAGTGCAA Chr15:102352190..102352210 60.33 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTGTGCCTCGTCTTCATT Chr15:102352227..102352247 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023051