Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27176
Trapped Gene
BC017647 (ENSMUSG00000037750)
Vector Insertion
Chr 11: 77967198 - 77969550
Public Clones not available
Private Clones OST67755 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000498263 (Chr11:77967199..77970839 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGCATCAGCACTACCTCA Chr11:77967955..77967974 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000498263 (Chr11:77967199..77970839 +)
Downstram Exon
ENSMUSE00000650165 (Chr11:77967199..77969549 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGCATCAGCACTACCTCA Chr11:77967955..77967974 60.01 55 TTGGGGGACATACGGAATTA Chr11:77969221..77969240 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650170 Chr11:77908214..77908293 No primer for this exon
upstream ENSMUSE00000650166 Chr11:77929128..77929339 CAGAGCCAACATCACCTCCT Chr11:77929306..77929325 60.26 55
upstream ENSMUSE00000289966 Chr11:77956595..77956716 ATGTTGTGCTGATGCTGGTC Chr11:77956611..77956630 59.71 50

*** Putative Vector Insertion (Chr 11: 77967198 - 77969550) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000498263 Chr11:77967199..77970839 TTGGGGGACATACGGAATTA Chr11:77969221..77969240 60.01 45
downstream ENSMUSE00000650165 Chr11:77967199..77969549 TTGGGGGACATACGGAATTA Chr11:77969221..77969240 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:77967249..77967269 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000037750