Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27181
Trapped Gene
Ubac1 (ENSMUSG00000036352)
Vector Insertion
Chr 2: 25871937 - 25876916
Public Clones not available
Private Clones OST67721 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000236743 (Chr2:25876917..25877231 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGACACATCGGTGGAGAAG Chr2:25876941..25876960 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000236743 (Chr2:25876917..25877231 -)
Downstram Exon
ENSMUSE00000236738 (Chr2:25871816..25871936 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGACACATCGGTGGAGAAG Chr2:25876941..25876960 60.11 55 CCAAGATCGTTTTGCTGTCA Chr2:25871815..25871834 59.84 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000236743 Chr2:25876917..25877231 AGGACACATCGGTGGAGAAG Chr2:25876941..25876960 60.11 55

*** Putative Vector Insertion (Chr 2: 25871937 - 25876916) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000236738 Chr2:25871816..25871936 CCAAGATCGTTTTGCTGTCA Chr2:25871815..25871834 59.84 45
downstream ENSMUSE00000236732 Chr2:25870412..25870485 TGGAGAAGGAACACGCTTTT Chr2:25870426..25870445 59.85 45
downstream ENSMUSE00000236726 Chr2:25866042..25866149 TGGAGCCTTTTGCTCTTGTT Chr2:25866104..25866123 59.99 45
downstream ENSMUSE00000236719 Chr2:25864681..25864783 TCTTCCGGAGTTCTGTCTGG Chr2:25864740..25864759 60.38 55
downstream ENSMUSE00000236713 Chr2:25864381..25864489 CAGTCTCATCCACTCGCTCA Chr2:25864426..25864445 60.14 55
downstream ENSMUSE00000236704 Chr2:25863239..25863473 GCATCTGCTCGAAATTCCTT Chr2:25863221..25863240 59.42 45
downstream ENSMUSE00000698330 Chr2:25863239..25863339 GCATCTGCTCGAAATTCCTT Chr2:25863221..25863240 59.42 45
downstream ENSMUSE00000236696 Chr2:25862047..25862133 CATCTCCATCAGCGAAATGA Chr2:25862088..25862107 59.76 45
downstream ENSMUSE00000236689 Chr2:25860846..25860984 CAGGATGGCCTGAAAGAGAG Chr2:25860873..25860892 59.94 55
downstream ENSMUSE00000340339 Chr2:25854068..25854587 ATACATTGGGCTCCACAAGC Chr2:25854146..25854165 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGACACATCGGTGGAGAAG Chr2:25873939..25873959 60.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGACACATCGGTGGAGAAG Chr2:25873939..25873959 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036352