Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27209
Trapped Gene
C230012O17Rik (ENSMUSG00000046219)
Vector Insertion
Chr 4: 24890213 - 24893529
Public Clones not available
Private Clones OST66760 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000675938 (Chr4:24893530..24893763 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCAGCGCTCGCTCTTAAA Chr4:24893557..24893576 62.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000675938 (Chr4:24893530..24893763 -)
Downstram Exon
ENSMUSE00000675937 (Chr4:24887937..24890212 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCAGCGCTCGCTCTTAAA Chr4:24893557..24893576 62.4 50 TTCTGCTGCAACATGGACTC Chr4:24889157..24889176 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675943 Chr4:24894571..24894596 No primer for this exon
upstream ENSMUSE00000675941 Chr4:24894062..24894091 No primer for this exon
upstream ENSMUSE00000396884 Chr4:24893766..24894059 AAAGTTCCCGAGGGTCACAG Chr4:24894033..24894052 61.44 55
upstream ENSMUSE00000675938 Chr4:24893530..24893763 AACCAGCGCTCGCTCTTAAA Chr4:24893557..24893576 62.4 50
upstream ENSMUSE00000675942 Chr4:24892246..24894097 ACCAGCTTGGACCCTTACCT Chr4:24893110..24893129 59.99 55

*** Putative Vector Insertion (Chr 4: 24890213 - 24893529) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000675937 Chr4:24887937..24890212 TTCTGCTGCAACATGGACTC Chr4:24889157..24889176 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTGCTCTACCACACGGCTA Chr4:24890478..24890499 59.95 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCACACGGCTACGTGACT Chr4:24890471..24890491 59.24 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046219