Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27213
Trapped Gene
Rhbdf1 (ENSMUSG00000020282)
Vector Insertion
Chr 11: 32116283 - 32122168
Public Clones IST15058D6 (tigm)
Private Clones OST66713 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662728 (Chr11:32122169..32122280 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662728 (Chr11:32122169..32122280 -)
Downstram Exon
ENSMUSE00000341408 (Chr11:32116142..32116282 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662728 Chr11:32122169..32122280 No primer for this exon

*** Putative Vector Insertion (Chr 11: 32116283 - 32122168) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000341408 Chr11:32116142..32116282 No primer for this exon
downstream ENSMUSE00000103056 Chr11:32115934..32116064 No primer for this exon
downstream ENSMUSE00000680150 Chr11:32115576..32115680 No primer for this exon
downstream ENSMUSE00000706126 Chr11:32114910..32115123 No primer for this exon
downstream ENSMUSE00000103050 Chr11:32114393..32114602 No primer for this exon
downstream ENSMUSE00000680152 Chr11:32114393..32114483 No primer for this exon
downstream ENSMUSE00000103049 Chr11:32114182..32114304 No primer for this exon
downstream ENSMUSE00000680146 Chr11:32114182..32114304 No primer for this exon
downstream ENSMUSE00000103069 Chr11:32113952..32114109 No primer for this exon
downstream ENSMUSE00000680145 Chr11:32113952..32114109 No primer for this exon
downstream ENSMUSE00000103046 Chr11:32113260..32113517 No primer for this exon
downstream ENSMUSE00000680144 Chr11:32113260..32113517 No primer for this exon
downstream ENSMUSE00000103044 Chr11:32113052..32113163 No primer for this exon
downstream ENSMUSE00000680143 Chr11:32113052..32113163 No primer for this exon
downstream ENSMUSE00000103042 Chr11:32112868..32112942 No primer for this exon
downstream ENSMUSE00000680141 Chr11:32112868..32112942 No primer for this exon
downstream ENSMUSE00000103047 Chr11:32112623..32112784 No primer for this exon
downstream ENSMUSE00000680139 Chr11:32112623..32112784 No primer for this exon
downstream ENSMUSE00000253178 Chr11:32111920..32112020 No primer for this exon
downstream ENSMUSE00000680138 Chr11:32111920..32112020 No primer for this exon
downstream ENSMUSE00000103043 Chr11:32111582..32111645 No primer for this exon
downstream ENSMUSE00000680137 Chr11:32111582..32111645 No primer for this exon
downstream ENSMUSE00000103057 Chr11:32111111..32111205 No primer for this exon
downstream ENSMUSE00000680136 Chr11:32111111..32111205 No primer for this exon
downstream ENSMUSE00000103054 Chr11:32110827..32110902 No primer for this exon
downstream ENSMUSE00000680135 Chr11:32110827..32110902 No primer for this exon
downstream ENSMUSE00000387499 Chr11:32110658..32110758 No primer for this exon
downstream ENSMUSE00000662726 Chr11:32110658..32110758 No primer for this exon
downstream ENSMUSE00000253150 Chr11:32110398..32110551 No primer for this exon
downstream ENSMUSE00000680134 Chr11:32110398..32110551 No primer for this exon
downstream ENSMUSE00000680133 Chr11:32109587..32110223 No primer for this exon
downstream ENSMUSE00000680153 Chr11:32109587..32110223 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCCACCATGGAACAACTT Chr11:32122116..32122136 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCTTCTGAGGACCCTACG Chr11:32122170..32122190 60.5 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTCAGGGTTGTCACTCAGCA Chr11:32116297..32116317 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTCAGGGTTGTCACTCAGCA Chr11:32116297..32116317 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020282