Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27216
Trapped Gene
AC131749.2 (ENSMUSG00000039585)
Vector Insertion
Chr 9: 59732400 - 59737219
Public Clones not available
Private Clones OST66575 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000533399 (Chr9:59732287..59732399 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGAGCAAGCAAAGCTCCAT Chr9:59732312..59732331 59.99 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000533399 (Chr9:59732287..59732399 +)
Downstram Exon
ENSMUSE00000533398 (Chr9:59737220..59737362 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGAGCAAGCAAAGCTCCAT Chr9:59732312..59732331 59.99 45 TGAGATCTCCGACTGGGAAG Chr9:59737316..59737335 60.34 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636327 Chr9:59723177..59723221 AGGCCTCTCACAGTGACTCC Chr9:59723196..59723215 59.43 60
upstream ENSMUSE00000533399 Chr9:59732287..59732399 ATGAGCAAGCAAAGCTCCAT Chr9:59732312..59732331 59.99 45

*** Putative Vector Insertion (Chr 9: 59732400 - 59737219) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000533398 Chr9:59737220..59737362 TGAGATCTCCGACTGGGAAG Chr9:59737316..59737335 60.34 55
downstream ENSMUSE00000533397 Chr9:59741948..59742171 TTGCCAATGCATAGAGTCCA Chr9:59742105..59742124 60.22 45
downstream ENSMUSE00000636319 Chr9:59742568..59742684 CGCCAATGCAGATGAATAAG Chr9:59742687..59742706 59.28 45
downstream ENSMUSE00000636318 Chr9:59743000..59743188 TCATTCCAATCACGTTGCTC Chr9:59743100..59743119 59.65 45
downstream ENSMUSE00000636317 Chr9:59744297..59744344 TCGGTTTCCTTTTTCCTCCT Chr9:59744343..59744362 60.05 45
downstream ENSMUSE00000636316 Chr9:59748157..59748268 TAAAGATGTGGCCATTGTGC Chr9:59748187..59748206 59.55 45
downstream ENSMUSE00000636315 Chr9:59750714..59750775 TGTGGTTTTTAGGCAGCACTT Chr9:59750759..59750779 59.8 42.86
downstream ENSMUSE00000636314 Chr9:59753699..59753891 GACCTTGTCGAAGCTCCTTG Chr9:59753885..59753904 59.99 55
downstream ENSMUSE00000230737 Chr9:59755155..59755283 ATCACGAAGCCATTGTTTGA Chr9:59755231..59755250 59.13 40
downstream ENSMUSE00000230718 Chr9:59756001..59756106 AGATGAGTTCGGGAGAGCTG Chr9:59756073..59756092 59.56 55
downstream ENSMUSE00000230706 Chr9:59757623..59757754 AATGGCCAAAGCATTAGCAG Chr9:59757677..59757696 60.23 45
downstream ENSMUSE00000230125 Chr9:59758391..59758514 TTTTCAGCAAATTCCAGGCTA Chr9:59758476..59758496 59.84 38.1
downstream ENSMUSE00000230103 Chr9:59769530..59769732 AGGGGAAGATGGACTTGGAT Chr9:59769580..59769599 59.76 50
downstream ENSMUSE00000229703 Chr9:59771428..59771549 ATCATCAGAGGCACGAGGTT Chr9:59771482..59771501 59.69 50
downstream ENSMUSE00000584283 Chr9:59772378..59775005 AGAGGCCCCAAAGATGAGAT Chr9:59772881..59772900 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACAT Chr9:59732449..59732470 60.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAGTATACACCACACACAAACA Chr9:59732408..59732432 60.25 41.67 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039585