Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27219
Trapped Gene
Jazf1 (ENSMUSG00000063568)
Vector Insertion
Chr 6: 52727699 - 52762096
Public Clones (cmhd)
Private Clones OST66526 (lexicon)
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000373459 (Chr6:52762097..52762293 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATTCAGCCGAAGCTTTCAC Chr6:52762226..52762245 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000373459 (Chr6:52762097..52762293 -)
Downstram Exon
ENSMUSE00000398052 (Chr6:52727529..52727698 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATTCAGCCGAAGCTTTCAC Chr6:52762226..52762245 59.96 50 ACATGGAGCTGAGGATTGCT Chr6:52727572..52727591 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561364 Chr6:53018447..53018589 CGATGTAGCACCATGACAGG Chr6:53018554..53018573 60.14 55
upstream ENSMUSE00000498105 Chr6:52843993..52844065 TGTGGCCCTCAGTTACATCA Chr6:52843997..52844016 60.11 50
upstream ENSMUSE00000373459 Chr6:52762097..52762293 GATTCAGCCGAAGCTTTCAC Chr6:52762226..52762245 59.96 50

*** Putative Vector Insertion (Chr 6: 52727699 - 52762096) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000398052 Chr6:52727529..52727698 ACATGGAGCTGAGGATTGCT Chr6:52727572..52727591 59.83 50
downstream ENSMUSE00000616922 Chr6:52718791..52720374 GCGTATTAGGCAACCGGTAA Chr6:52718840..52718859 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCTGGGGACAAAACAAGTA Chr6:52729118..52729139 60.89 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCTGGGGACAAAACAAGTA Chr6:52729118..52729139 60.89 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGTGCTGAGTTTCCACCAA Chr6:52729267..52729287 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGTGCTGAGTTTCCACCAA Chr6:52729267..52729287 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063568