Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27225
Trapped Gene
Ccnt2 (ENSMUSG00000026349)
Vector Insertion
Chr 1: 129689996 - 129691831
Public Clones not available
Private Clones OST66288 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158245 (Chr1:129689935..129689995 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158245 (Chr1:129689935..129689995 +)
Downstram Exon
ENSMUSE00000158243 (Chr1:129691832..129691894 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGTGGGTGTTCAATGGTGAT Chr1:129691862..129691881 59.66 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000344861 Chr1:129670741..129670962 GAAGCGGATGAAGAGCTGTC Chr1:129670889..129670908 60.1 55
upstream ENSMUSE00000710550 Chr1:129670741..129670962 GAAGCGGATGAAGAGCTGTC Chr1:129670889..129670908 60.1 55
upstream ENSMUSE00000158247 Chr1:129671678..129671759 ATATGCACCATTCCTTCACCA Chr1:129671725..129671745 60.21 42.86
upstream ENSMUSE00000158249 Chr1:129688182..129688310 ACGCTTGTCTTCATCCCCTA Chr1:129688264..129688283 59.69 50
upstream ENSMUSE00000158245 Chr1:129689935..129689995 No primer for this exon

*** Putative Vector Insertion (Chr 1: 129689996 - 129691831) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158243 Chr1:129691832..129691894 TGTGGGTGTTCAATGGTGAT Chr1:129691862..129691881 59.66 45
downstream ENSMUSE00000320862 Chr1:129694418..129694463 GGATGTCTGTGCCAAATCCT Chr1:129694446..129694465 59.93 50
downstream ENSMUSE00000158250 Chr1:129695967..129696130 GTAACCGTGGGGTCCACATA Chr1:129696116..129696135 60.49 55
downstream ENSMUSE00000158242 Chr1:129698183..129698253 TCCAGTTTCGAATCCTCTTCA Chr1:129698253..129698273 59.8 42.86
downstream ENSMUSE00000158248 Chr1:129698739..129699870 TGCACGGCTATCTTGAACAG Chr1:129698942..129698961 60.01 50
downstream ENSMUSE00000692282 Chr1:129698739..129701414 GCACCACATTCCCGTCTAGT Chr1:129700792..129700811 60 55
downstream ENSMUSE00000692276 Chr1:129699969..129702509 GCACCACATTCCCGTCTAGT Chr1:129700792..129700811 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAACACTGGGTATGTGTGCTT Chr1:129689987..129690009 59.96 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACACTGGGTATGTGTGCTT Chr1:129689987..129690009 59.96 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026349