Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27228
Trapped Gene
Mphosph6 (ENSMUSG00000031843)
Vector Insertion
Chr 8: 120323057 - 120325751
Public Clones D117H04 (ggtc) D165D04 (ggtc)
Private Clones OST66266 (lexicon) OST33241 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000320735 (Chr8:120325752..120325829 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGGAGCGCAAGACTAAGTT Chr8:120325777..120325796 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000320735 (Chr8:120325752..120325829 -)
Downstram Exon
ENSMUSE00000320725 (Chr8:120322944..120323056 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGGAGCGCAAGACTAAGTT Chr8:120325777..120325796 60.15 50 CTGATCATCTTCCGCTCCTC Chr8:120322967..120322986 59.91 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000320735 Chr8:120325752..120325829 TCGGAGCGCAAGACTAAGTT Chr8:120325777..120325796 60.15 50

*** Putative Vector Insertion (Chr 8: 120323057 - 120325751) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000320725 Chr8:120322944..120323056 CTGATCATCTTCCGCTCCTC Chr8:120322967..120322986 59.91 55
downstream ENSMUSE00000320718 Chr8:120318481..120318571 TCAGGATTAAACCCCCTGAA Chr8:120318466..120318485 59.36 45
downstream ENSMUSE00000213654 Chr8:120316579..120316676 TCGACCTCTACCGTCTCGTC Chr8:120316584..120316603 60.41 60
downstream ENSMUSE00000320701 Chr8:120315545..120316218 ACCAGTACCGACGACAGGAG Chr8:120315988..120316007 60.17 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGAGCTCTAATCGCCTTG Chr8:120325689..120325709 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCGGAGCGCAAGACTAAGTT Chr8:120325775..120325796 60.94 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATAATCGCCTTGCAGCACA Chr8:120325761..120325781 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCGCAAGACTACGTGACTG Chr8:120325771..120325791 59.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031843