Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27233
Trapped Gene
Mecr (ENSMUSG00000028910)
Vector Insertion
Chr 4: 131418832 - 131418907
Public Clones not available
Private Clones OST66153 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000183339 (Chr4:131418833..131418906 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGCTCTCAACTGTGTTGG Chr4:131418851..131418870 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000183339 (Chr4:131418833..131418906 +)
Downstram Exon
ENSMUSE00000668083 (Chr4:131418833..131418906 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGCTCTCAACTGTGTTGG Chr4:131418851..131418870 59.87 50 CTTCCCACCAACACAGTTGA Chr4:131418880..131418899 59.56 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000310611 Chr4:131399409..131399593 CGGACCACATCCTCCTACTC Chr4:131399502..131399521 59.53 60
upstream ENSMUSE00000668086 Chr4:131408239..131408340 ACCGGAAGTCTGGTCCTTGT Chr4:131408289..131408308 60.94 55
upstream ENSMUSE00000310603 Chr4:131409631..131409728 CACTGCTGTGGAAGGATCTG Chr4:131409649..131409668 59.42 55
upstream ENSMUSE00000183336 Chr4:131410500..131410631 CTGCATTGAAGCCAGGAGAT Chr4:131410584..131410603 60.36 50
upstream ENSMUSE00000183340 Chr4:131413672..131413815 CTAGGTGTCAACCCCTGCAC Chr4:131413755..131413774 60.57 60
upstream ENSMUSE00000708605 Chr4:131416676..131416778 CAGTCATTCAGATCGCCTCA Chr4:131416721..131416740 59.94 50
upstream ENSMUSE00000720365 Chr4:131416676..131416778 CAGTCATTCAGATCGCCTCA Chr4:131416721..131416740 59.94 50
upstream ENSMUSE00000183337 Chr4:131417691..131417793 TAAGGATGCCCGAGACAAAA Chr4:131417762..131417781 60.58 45
upstream ENSMUSE00000668084 Chr4:131417691..131417793 TAAGGATGCCCGAGACAAAA Chr4:131417762..131417781 60.58 45

*** Putative Vector Insertion (Chr 4: 131418832 - 131418907) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000183339 Chr4:131418833..131418906 CTTCCCACCAACACAGTTGA Chr4:131418880..131418899 59.56 50
downstream ENSMUSE00000668083 Chr4:131418833..131418906 CTTCCCACCAACACAGTTGA Chr4:131418880..131418899 59.56 50
downstream ENSMUSE00000183338 Chr4:131420972..131421032 TTACAGGCTGTTTGGCCATT Chr4:131421024..131421043 60.5 45
downstream ENSMUSE00000668082 Chr4:131420972..131421032 TTACAGGCTGTTTGGCCATT Chr4:131421024..131421043 60.5 45
downstream ENSMUSE00000310569 Chr4:131421171..131421243 CTTCCACTGGGACAACCAAA Chr4:131421230..131421249 60.92 50
downstream ENSMUSE00000668081 Chr4:131421171..131421243 CTTCCACTGGGACAACCAAA Chr4:131421230..131421249 60.92 50
downstream ENSMUSE00000436404 Chr4:131423362..131423683 ATATGGGTGAGGCAGTCTGG Chr4:131423621..131423640 59.95 55
downstream ENSMUSE00000668080 Chr4:131423362..131423683 ATATGGGTGAGGCAGTCTGG Chr4:131423621..131423640 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGCTCTCAACTGTGTTGG Chr4:131418852..131418872 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGCTCTCAACTGTGTTGG Chr4:131418852..131418872 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028910