Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27245
Trapped Gene
Cldn15 (ENSMUSG00000001739)
Vector Insertion
Chr 5: 137450393 - 137450479
Public Clones not available
Private Clones OST65813 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311348 (Chr5:137450311..137450392 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311348 (Chr5:137450311..137450392 +)
Downstram Exon
ENSMUSE00000191927 (Chr5:137450480..137450596 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686654 Chr5:137442486..137442498 No primer for this exon
upstream ENSMUSE00000686653 Chr5:137443714..137444193 No primer for this exon
upstream ENSMUSE00000311356 Chr5:137443739..137444193 No primer for this exon
upstream ENSMUSE00000311352 Chr5:137448190..137448354 No primer for this exon
upstream ENSMUSE00000311348 Chr5:137450311..137450392 No primer for this exon

*** Putative Vector Insertion (Chr 5: 137450393 - 137450479) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000191927 Chr5:137450480..137450596 No primer for this exon
downstream ENSMUSE00000505388 Chr5:137450684..137451710 No primer for this exon
downstream ENSMUSE00000686652 Chr5:137450684..137451728 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAACCCACTGTATGCTGGA Chr5:137450369..137450389 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAACCCACTGTATGCTGGA Chr5:137450369..137450389 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001739