Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27257
Trapped Gene
Polh (ENSMUSG00000023953)
Vector Insertion
Chr 17: 46336484 - 46339345
Public Clones not available
Private Clones OST65508 (lexicon) OST55750 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000515197 (Chr17:46339346..46339544 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAGCCTAGGGCTACCTAC Chr17:46339474..46339493 59.22 65 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000515197 (Chr17:46339346..46339544 -)
Downstram Exon
ENSMUSE00000136615 (Chr17:46336341..46336483 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAGCCTAGGGCTACCTAC Chr17:46339474..46339493 59.22 65 GAGCAACCACTCGATTCTGC Chr17:46336425..46336444 60.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000515197 Chr17:46339346..46339544 GGGAGCCTAGGGCTACCTAC Chr17:46339474..46339493 59.22 65

*** Putative Vector Insertion (Chr 17: 46336484 - 46339345) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136615 Chr17:46336341..46336483 GAGCAACCACTCGATTCTGC Chr17:46336425..46336444 60.96 55
downstream ENSMUSE00000136618 Chr17:46335583..46335717 CGGGCTTCATAGCTAACTGC Chr17:46335669..46335688 60 55
downstream ENSMUSE00000136621 Chr17:46331151..46331365 GCACGTTCAATCACAGCAAA Chr17:46331281..46331300 60.85 45
downstream ENSMUSE00000136614 Chr17:46327556..46327725 GCAAGCCTTGTTTCCGAATA Chr17:46327680..46327699 60.21 45
downstream ENSMUSE00000136616 Chr17:46324976..46325079 GGCGGTTGGGCTTATTTAGT Chr17:46325015..46325034 60.33 50
downstream ENSMUSE00000136620 Chr17:46321639..46321758 CAGAAGCCCCTAGCTTTCCT Chr17:46321705..46321724 59.98 55
downstream ENSMUSE00000136619 Chr17:46319634..46319757 ACCTCGACACATGGCATACA Chr17:46319708..46319727 59.99 50
downstream ENSMUSE00000342635 Chr17:46318415..46318480 ACTGCAAAAGCCACCACTGT Chr17:46318437..46318456 60.75 50
downstream ENSMUSE00000498467 Chr17:46312100..46312269 GCTCATCTTGTGAGCGTCAT Chr17:46312134..46312153 58.99 50
downstream ENSMUSE00000410035 Chr17:46308305..46310045 AACTTGGTAGCGCAGAGGAA Chr17:46309982..46310001 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGGTGTCGCCTTGGTAAG Chr17:46339339..46339359 60.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGATGGCTTTTGACGTGACT Chr17:46339287..46339307 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023953