Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27260
Trapped Gene
Pan3 (ENSMUSG00000029647)
Vector Insertion
Chr 5: 148314779 - 148331080
Public Clones not available
Private Clones OST65480 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000684335 (Chr5:148314715..148314778 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCGTTGGACAGCTCTATG Chr5:148314755..148314774 59.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000684335 (Chr5:148314715..148314778 +)
Downstram Exon
ENSMUSE00000589425 (Chr5:148331081..148331328 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCGTTGGACAGCTCTATG Chr5:148314755..148314774 59.62 55 AGGTGCTGGGGTTGTATCTG Chr5:148331319..148331338 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000589443 Chr5:148242465..148242585 No primer for this exon
upstream ENSMUSE00000710862 Chr5:148262229..148262350 TCAGCACCAGCTTTATTGGA Chr5:148262283..148262302 59.42 45
upstream ENSMUSE00000716210 Chr5:148262229..148262350 TCAGCACCAGCTTTATTGGA Chr5:148262283..148262302 59.42 45
upstream ENSMUSE00000589441 Chr5:148264828..148264894 CAGTGCCAAGCCATACACAG Chr5:148264869..148264888 60.32 55
upstream ENSMUSE00000647681 Chr5:148264828..148264894 CAGTGCCAAGCCATACACAG Chr5:148264869..148264888 60.32 55
upstream ENSMUSE00000589428 Chr5:148266694..148266764 TCAACATCTCCCAGAGAAGGA Chr5:148266742..148266762 59.79 47.62
upstream ENSMUSE00000589440 Chr5:148266694..148266764 TCAACATCTCCCAGAGAAGGA Chr5:148266742..148266762 59.79 47.62
upstream ENSMUSE00000589427 Chr5:148299687..148299834 TGGGAAGTCCTGCTACTGCT Chr5:148299802..148299821 60.01 55
upstream ENSMUSE00000589439 Chr5:148299687..148299834 TGGGAAGTCCTGCTACTGCT Chr5:148299802..148299821 60.01 55
upstream ENSMUSE00000684335 Chr5:148314715..148314778 CAGCGTTGGACAGCTCTATG Chr5:148314755..148314774 59.62 55

*** Putative Vector Insertion (Chr 5: 148314779 - 148331080) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000533470 Chr5:148331081..148331328 AGGTGCTGGGGTTGTATCTG Chr5:148331319..148331338 59.99 55
downstream ENSMUSE00000589425 Chr5:148331081..148331328 AGGTGCTGGGGTTGTATCTG Chr5:148331319..148331338 59.99 55
downstream ENSMUSE00000533469 Chr5:148333406..148333510 GAAGGTGCATTTGCTTTTGG Chr5:148333485..148333504 60.62 45
downstream ENSMUSE00000589424 Chr5:148333406..148333510 GAAGGTGCATTTGCTTTTGG Chr5:148333485..148333504 60.62 45
downstream ENSMUSE00000647695 Chr5:148334752..148334809 GGTCAATTTGAGCCATCGTT Chr5:148334797..148334816 59.94 45
downstream ENSMUSE00000647692 Chr5:148338095..148338256 GGTGGCAGTGGTTCTAGAGG Chr5:148338155..148338174 59.72 60
downstream ENSMUSE00000533463 Chr5:148338501..148338617 TCAACCAACACCATGCACTT Chr5:148338543..148338562 60.01 45
downstream ENSMUSE00000647691 Chr5:148338705..148338806 GGAAATCATAGGCGAACACC Chr5:148338731..148338750 59.39 50
downstream ENSMUSE00000647689 Chr5:148341531..148341696 TGTATGAATGGTCCGCAGAG Chr5:148341640..148341659 59.67 50
downstream ENSMUSE00000647688 Chr5:148342793..148342883 GAGCCATTAATGCCAAAGGA Chr5:148342878..148342897 60.04 45
downstream ENSMUSE00000647687 Chr5:148347977..148348116 GCCAAAGCCAACACAACTTT Chr5:148348023..148348042 60.15 45
downstream ENSMUSE00000647686 Chr5:148350819..148350948 ATTCACACTCCGCATCCTGT Chr5:148350861..148350880 60.54 50
downstream ENSMUSE00000647685 Chr5:148351318..148351382 No primer for this exon
downstream ENSMUSE00000647684 Chr5:148354646..148354784 TCTGACCAGGTTGGATCCTT Chr5:148354675..148354694 59.51 50
downstream ENSMUSE00000191017 Chr5:148357182..148357311 AGCACGCTCTTCTCGTCTCT Chr5:148357243..148357262 59.5 55
downstream ENSMUSE00000684337 Chr5:148357941..148360072 AAAATCTCCAGCCCGCTTAT Chr5:148359163..148359182 60.06 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCGTTGGACAGCTCTATG Chr5:148326756..148326776 59.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTCCCGTGACTGGGAAAAC Chr5:148326825..148326845 61.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029647