Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27279
Trapped Gene
Sf3b1 (ENSMUSG00000025982)
Vector Insertion
Chr 1: 55045000 - 55047146
Public Clones not available
Private Clones OST65168 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000546829 (Chr1:55047147..55047419 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTGTGACGCCTTTACTTG Chr1:55047166..55047185 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000546829 (Chr1:55047147..55047419 -)
Downstram Exon
ENSMUSE00000154648 (Chr1:55044783..55044999 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTGTGACGCCTTTACTTG Chr1:55047166..55047185 60.05 50 TCTGCATGGTCCAATAGCAA Chr1:55044782..55044801 60.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000404773 Chr1:55084183..55084323 CAGTTCCGTCTGTGTGTTCG Chr1:55084221..55084240 60.35 55
upstream ENSMUSE00000154641 Chr1:55076078..55076244 GGCCTTGATTCCACAGGTTA Chr1:55076160..55076179 59.93 50
upstream ENSMUSE00000154640 Chr1:55073623..55073727 CGTGGCGTTGCTTAATGATA Chr1:55073643..55073662 59.72 45
upstream ENSMUSE00000154628 Chr1:55073220..55073334 AGCATAGGCGGACCATGATA Chr1:55073254..55073273 60.46 50
upstream ENSMUSE00000154631 Chr1:55071327..55071406 GGGAAGACTCCCGATCCTAA Chr1:55071385..55071404 60.4 55
upstream ENSMUSE00000154627 Chr1:55068946..55069116 ATCAGACCGCTGACCAGACT Chr1:55068991..55069010 59.87 55
upstream ENSMUSE00000154647 Chr1:55064324..55064561 CTGGGCATACCCCATCTTTA Chr1:55064538..55064557 59.78 50
upstream ENSMUSE00000154624 Chr1:55063015..55063227 AGTCTCGTTGGGATGAAACG Chr1:55063109..55063128 60.11 50
upstream ENSMUSE00000154637 Chr1:55062646..55062767 GAGCATGACACCTGAACAGC Chr1:55062738..55062757 59.42 55
upstream ENSMUSE00000243904 Chr1:55060137..55060334 CCTCCAGCTGGTTATGTTCC Chr1:55060306..55060325 59.55 55
upstream ENSMUSE00000243895 Chr1:55059948..55060049 No primer for this exon
upstream ENSMUSE00000243887 Chr1:55058227..55058406 AATTTGGAGCTGGACCACTG Chr1:55058353..55058372 60.11 50
upstream ENSMUSE00000154632 Chr1:55057856..55057942 TGGTTATCGAGCCACTGTTG Chr1:55057916..55057935 59.72 50
upstream ENSMUSE00000243870 Chr1:55057488..55057758 GAGCTTTTGCTGTCGTAGCC Chr1:55057657..55057676 60.16 55
upstream ENSMUSE00000243861 Chr1:55057086..55057231 AAAGTTCGGACCATCAGTGC Chr1:55057192..55057211 60.12 50
upstream ENSMUSE00000154636 Chr1:55056859..55057005 TGGATGCAGAATATGCCAAC Chr1:55056940..55056959 59.5 45
upstream ENSMUSE00000154644 Chr1:55056471..55056596 CTTTTGGCAACACAGAATGG Chr1:55056497..55056516 59.17 45
upstream ENSMUSE00000154629 Chr1:55054882..55055103 GGTAATCTAGGCGCAGCAGA Chr1:55054952..55054971 60.51 55
upstream ENSMUSE00000243834 Chr1:55053856..55054038 CTTGGCAAACGAGTCAAACC Chr1:55053977..55053996 60.67 50
upstream ENSMUSE00000243830 Chr1:55053661..55053772 CCTGAAGTATTGGGCAGCAT Chr1:55053696..55053715 60.1 50
upstream ENSMUSE00000154642 Chr1:55052210..55052330 TGATCTTGTTGGACGCATTG Chr1:55052217..55052236 60.67 45
upstream ENSMUSE00000154633 Chr1:55051174..55051305 TGGATGAGGATTTGCTTTGA Chr1:55051258..55051277 59.2 40
upstream ENSMUSE00000546829 Chr1:55047147..55047419 TGCTGTGACGCCTTTACTTG Chr1:55047166..55047185 60.05 50

*** Putative Vector Insertion (Chr 1: 55045000 - 55047146) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000154648 Chr1:55044783..55044999 TCTGCATGGTCCAATAGCAA Chr1:55044782..55044801 60.22 45
downstream ENSMUSE00000546850 Chr1:55042016..55044336 ATAGTTTGCGTGCTGCTGTG Chr1:55043713..55043732 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGTGACGCCTTTACTTG Chr1:55047164..55047184 60.05 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTGTGACGCCTTTACTTG Chr1:55047164..55047184 60.05 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025982