Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27286
Trapped Gene
Ckap2l (ENSMUSG00000048327)
Vector Insertion
Chr 2: 129122117 - 129122840
Public Clones (sanger)
Private Clones OST64977 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000381368 (Chr2:129122841..129122900 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAACTGTCGCCGTAGAGC Chr2:129122879..129122898 59.64 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000381368 (Chr2:129122841..129122900 -)
Downstram Exon
ENSMUSE00000334513 (Chr2:129122050..129122116 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAACTGTCGCCGTAGAGC Chr2:129122879..129122898 59.64 55 TTGGGGTCCTTTAGCTTTCC Chr2:129122034..129122053 60.42 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000381368 Chr2:129122841..129122900 AGAAACTGTCGCCGTAGAGC Chr2:129122879..129122898 59.64 55

*** Putative Vector Insertion (Chr 2: 129122117 - 129122840) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000334513 Chr2:129122050..129122116 TTGGGGTCCTTTAGCTTTCC Chr2:129122034..129122053 60.42 50
downstream ENSMUSE00000363124 Chr2:129116694..129116745 TTTGGGGCAGATATTCTTGG Chr2:129116690..129116709 59.89 45
downstream ENSMUSE00000401298 Chr2:129110593..129111836 TCTCATGTTAGGCGTGCTTG Chr2:129110786..129110805 60.01 50
downstream ENSMUSE00000398095 Chr2:129107628..129107835 CCTTTGGATTTCTGCCATTC Chr2:129107781..129107800 59.51 45
downstream ENSMUSE00000355542 Chr2:129101226..129101381 GGCAAATTTTTCAGCCTCAG Chr2:129101297..129101316 59.82 45
downstream ENSMUSE00000382721 Chr2:129098233..129098293 TGCATGGGTCTTGTAGAACG Chr2:129098223..129098242 59.72 50
downstream ENSMUSE00000411806 Chr2:129096311..129096497 GCTGCTCAGATTCCTCCTTG Chr2:129096398..129096417 60.1 55
downstream ENSMUSE00000377645 Chr2:129094619..129094999 TGTCTTGCACTTCTGGCATC Chr2:129094949..129094968 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr2:129122770..129122790 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGAAACTGTCGCCGTAG Chr2:129122880..129122900 59.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 GGAAGAAACTGTCGCCGTAG Chr2:129122880..129122900 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048327