Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27292
Trapped Gene
Ndufc2 (ENSMUSG00000030647)
Vector Insertion
Chr 7: 104555520 - 104556128
Public Clones not available
Private Clones OST64815 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000201580 (Chr7:104555376..104555519 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGCTTCTGTTCGTTACGTC Chr7:104555386..104555406 59.93 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000201580 (Chr7:104555376..104555519 +)
Downstram Exon
ENSMUSE00000201581 (Chr7:104556129..104556309 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGCTTCTGTTCGTTACGTC Chr7:104555386..104555406 59.93 52.38 TGAAAACTTCAACGCACTGG Chr7:104556189..104556208 59.88 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000201579 Chr7:104548606..104548867 GCGTTTGGAGTCGTTGTTTT Chr7:104548631..104548650 60.15 45
upstream ENSMUSE00000201580 Chr7:104555376..104555519 CCAGCTTCTGTTCGTTACGTC Chr7:104555386..104555406 59.93 52.38

*** Putative Vector Insertion (Chr 7: 104555520 - 104556128) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000201581 Chr7:104556129..104556309 TGAAAACTTCAACGCACTGG Chr7:104556189..104556208 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000030647