Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27298
Trapped Gene
2900002K06Rik (ENSMUSG00000055188)
Vector Insertion
Chr X: 7723745 - 7724681
Public Clones IST12712C4 (tigm) IST12518D1 (tigm) IST12459A11 (tigm) IST11881A9 (tigm)
IST12507B3 (tigm) IST12697A3BBF1 (tigm) IST12495B4 (tigm) IST12103A9 (tigm)
IST12496C11 (tigm) IST14745G12 (tigm) IST11777C3 (tigm) IST12476H1 (tigm)
IST12513D7 (tigm) IST10046E4 (tigm) IST12487E10 (tigm) IST12156H10 (tigm)
IST12157H6 (tigm) IST12495B7 (tigm) IST10046E4 (tigm) IST11777A3 (tigm)
Private Clones OST64612 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703584 (ChrX:7723618..7723744 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGATTTGCTACCCTTTGGA ChrX:7723703..7723722 60.58 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703584 (ChrX:7723618..7723744 +)
Downstram Exon
ENSMUSE00000703583 (ChrX:7724682..7725084 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGATTTGCTACCCTTTGGA ChrX:7723703..7723722 60.58 45 AAGTTCGAGCCTGTGTGAGG ChrX:7725007..7725026 60.44 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000240138 ChrX:7722553..7722857 AAAAGTCAGAGGACGGCAGA ChrX:7722773..7722792 59.99 50
upstream ENSMUSE00000703584 ChrX:7723618..7723744 TCGATTTGCTACCCTTTGGA ChrX:7723703..7723722 60.58 45

*** Putative Vector Insertion (Chr X: 7723745 - 7724681) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000703583 ChrX:7724682..7725084 AAGTTCGAGCCTGTGTGAGG ChrX:7725007..7725026 60.44 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTGCTACCCTTTGGATGC ChrX:7723707..7723727 59.05 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTGCTACCCTTTGGATGC ChrX:7723707..7723727 59.05 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055188