Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27301
Trapped Gene
Fig4 (ENSMUSG00000038417)
Vector Insertion
Chr 10: 40997321 - 41005095
Public Clones not available
Private Clones OST64300 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000299036 (Chr10:41005096..41005219 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGTCTCAGCTTTTGGAGTC Chr10:41005100..41005119 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000299036 (Chr10:41005096..41005219 -)
Downstram Exon
ENSMUSE00000299032 (Chr10:40997164..40997320 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGTCTCAGCTTTTGGAGTC Chr10:41005100..41005119 59.99 55 GGGTGAGAAATCCGAACAGA Chr10:40997154..40997173 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000299043 Chr10:41022793..41023047 GTCTGGTGTGCTGGAGGTCT Chr10:41022958..41022977 60.31 60
upstream ENSMUSE00000299038 Chr10:41005407..41005505 TTGGTGGTAATCGACGACAG Chr10:41005408..41005427 59.57 50
upstream ENSMUSE00000299036 Chr10:41005096..41005219 CCGTCTCAGCTTTTGGAGTC Chr10:41005100..41005119 59.99 55

*** Putative Vector Insertion (Chr 10: 40997321 - 41005095) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000299032 Chr10:40997164..40997320 GGGTGAGAAATCCGAACAGA Chr10:40997154..40997173 60.05 50
downstream ENSMUSE00000299027 Chr10:40992764..40992814 No primer for this exon
downstream ENSMUSE00000299022 Chr10:40990105..40990253 CATTCGCAGGACGGTAAGAT Chr10:40990177..40990196 60.1 50
downstream ENSMUSE00000299017 Chr10:40987493..40987621 ATCCAGAAGTTCACCGTTCC Chr10:40987538..40987557 58.99 50
downstream ENSMUSE00000299011 Chr10:40985192..40985292 GTCCCAGCAAACCTACTGGA Chr10:40985201..40985220 60.11 55
downstream ENSMUSE00000299003 Chr10:40983691..40983853 CAGAGGATCTGCTCGGTCTC Chr10:40983791..40983810 60.1 60
downstream ENSMUSE00000298997 Chr10:40982875..40982972 TGGAGCATCTGGTCAAAGTG Chr10:40982893..40982912 59.83 50
downstream ENSMUSE00000298991 Chr10:40977821..40977954 TCAGGATCCTTTCGTGCTTT Chr10:40977899..40977918 59.81 45
downstream ENSMUSE00000298986 Chr10:40976227..40976343 CGAGAACGTTGCACAGCTTA Chr10:40976302..40976321 60.19 50
downstream ENSMUSE00000298981 Chr10:40974650..40974695 TGGGAATCACATGACCTCCT Chr10:40974642..40974661 60.33 50
downstream ENSMUSE00000298977 Chr10:40973446..40973594 ACAGTTGGTTCGAAGGATGC Chr10:40973549..40973568 60.12 50
downstream ENSMUSE00000298967 Chr10:40971523..40971689 GGTCTTTACCCGATGAACCA Chr10:40971583..40971602 59.79 50
downstream ENSMUSE00000298961 Chr10:40960311..40960449 TTCTGTGGGGTGGAAAACAC Chr10:40960372..40960391 60.79 50
downstream ENSMUSE00000298954 Chr10:40953358..40953416 TCTGGCGTCCACCAGTAAGT Chr10:40953371..40953390 60.71 55
downstream ENSMUSE00000298944 Chr10:40951913..40952060 ATACGGCCGGAAGAACTCAT Chr10:40951944..40951963 60.85 50
downstream ENSMUSE00000298937 Chr10:40949813..40949896 CTGGTTTTCGCACGGTAAAT Chr10:40949816..40949835 60 45
downstream ENSMUSE00000298926 Chr10:40947913..40948108 TGTCTCCCGTGTCAGTCATC Chr10:40947908..40947927 59.67 55
downstream ENSMUSE00000298912 Chr10:40946728..40946810 No primer for this exon
downstream ENSMUSE00000298903 Chr10:40940705..40940791 TGGTTACCTCGGTCCTGTTT Chr10:40940722..40940741 59.45 50
downstream ENSMUSE00000298895 Chr10:40907978..40908505 TTGTCTTGCGAGAAAGCTGA Chr10:40908454..40908473 59.86 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCCCTTGCCTGTTTCTTT Chr10:41002062..41002082 60.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCCCTTGCCTGTTTCTTT Chr10:41002062..41002082 60.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038417