Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27313
Trapped Gene
Mtrf1 (ENSMUSG00000022022)
Vector Insertion
Chr 14: 79799607 - 79801228
Public Clones not available
Private Clones OST63886 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000388382 (Chr14:79799499..79799606 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATCCCAAGGTGGAGAATGA Chr14:79799531..79799550 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000388382 (Chr14:79799499..79799606 +)
Downstram Exon
ENSMUSE00000342422 (Chr14:79801229..79801654 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATCCCAAGGTGGAGAATGA Chr14:79799531..79799550 59.86 50 CTTCTGTGTAAGGCCCTTCG Chr14:79801568..79801587 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000354994 Chr14:79797579..79797843 CCGTTACGGACACCTAAGGA Chr14:79797698..79797717 59.99 55
upstream ENSMUSE00000388382 Chr14:79799499..79799606 GATCCCAAGGTGGAGAATGA Chr14:79799531..79799550 59.86 50

*** Putative Vector Insertion (Chr 14: 79799607 - 79801228) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000342422 Chr14:79801229..79801654 CTTCTGTGTAAGGCCCTTCG Chr14:79801568..79801587 59.87 55
downstream ENSMUSE00000123026 Chr14:79802632..79802723 CTTGCAACTGCTTTTCATCTTG Chr14:79802665..79802686 60.05 40.91
downstream ENSMUSE00000123020 Chr14:79806384..79806465 AGGCACTAAACGCTCCAAAA Chr14:79806407..79806426 59.88 45
downstream ENSMUSE00000123019 Chr14:79806653..79806760 TTCAGCAGCTCAAATTTCCA Chr14:79806743..79806762 59.54 40
downstream ENSMUSE00000123025 Chr14:79811449..79811621 TGGATTCCGCCTTCATACTT Chr14:79811527..79811546 59.53 45
downstream ENSMUSE00000123024 Chr14:79812794..79812911 TCCTCTGGCTCGAAATGTGT Chr14:79812853..79812872 60.8 50
downstream ENSMUSE00000123021 Chr14:79815685..79815821 TGATCGTTCTTGTTGGCACT Chr14:79815719..79815738 59.29 45
downstream ENSMUSE00000123018 Chr14:79818995..79819093 TGTCCGAATTCTCTCCGACT Chr14:79819033..79819052 59.8 50
downstream ENSMUSE00000375644 Chr14:79823204..79823394 AAAATTCGGAAATGGCCTCT Chr14:79823291..79823310 59.91 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr14:79799657..79799677 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGGCTTCTGAATCGTGAC Chr14:79799644..79799664 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022022