Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27327
Trapped Gene
Hirip3 (ENSMUSG00000042606)
Vector Insertion
Chr 7: 134008000 - 134008076
Public Clones not available
Private Clones OST63242 (lexicon)
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000292742 (Chr7:134007834..134007999 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGTTACATTCGAGCCTGT Chr7:134007880..134007899 59.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000292742 (Chr7:134007834..134007999 +)
Downstram Exon
ENSMUSE00000292736 (Chr7:134008077..134008175 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGTTACATTCGAGCCTGT Chr7:134007880..134007899 59.9 50 GCGACACTTCTCCAAGGAAG Chr7:134008105..134008124 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000339090 Chr7:134005953..134006030 CGAAAATTCACTCGCAGCTT Chr7:134005987..134006006 60.52 45
upstream ENSMUSE00000384940 Chr7:134006114..134006234 AAGAGAAGCAGGCGTTGAAG Chr7:134006182..134006201 59.76 50
upstream ENSMUSE00000339006 Chr7:134006332..134006440 CCTGCAGTGACCCAAAGAAG Chr7:134006393..134006412 60.82 55
upstream ENSMUSE00000369751 Chr7:134006683..134007764 GTGCTAACTGCCAGGAGGAG Chr7:134007058..134007077 60.01 60
upstream ENSMUSE00000292742 Chr7:134007834..134007999 AGCGTTACATTCGAGCCTGT Chr7:134007880..134007899 59.9 50

*** Putative Vector Insertion (Chr 7: 134008000 - 134008076) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000292736 Chr7:134008077..134008175 GCGACACTTCTCCAAGGAAG Chr7:134008105..134008124 59.99 55
downstream ENSMUSE00000361296 Chr7:134008248..134008636 CTGTCACCGTCACTGCTGAT Chr7:134008407..134008426 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGAGGGGTGTGCCTGAGAT Chr7:134008003..134008023 61.62 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042606