Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27342
Trapped Gene
Dcbld1 (ENSMUSG00000019891)
Vector Insertion
Chr 10: 52031247 - 52032619
Public Clones not available
Private Clones OST62568 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000487939 (Chr10:52031206..52031246 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000487939 (Chr10:52031206..52031246 +)
Downstram Exon
ENSMUSE00000098830 (Chr10:52032620..52032707 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000502943 Chr10:51953425..51953641 No primer for this exon
upstream ENSMUSE00000466026 Chr10:51981533..51981745 No primer for this exon
upstream ENSMUSE00000302877 Chr10:52003909..52004043 No primer for this exon
upstream ENSMUSE00000302871 Chr10:52006154..52006205 No primer for this exon
upstream ENSMUSE00000302865 Chr10:52010657..52010729 No primer for this exon
upstream ENSMUSE00000490106 Chr10:52024393..52024526 No primer for this exon
upstream ENSMUSE00000487939 Chr10:52031206..52031246 No primer for this exon

*** Putative Vector Insertion (Chr 10: 52031247 - 52032619) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000098830 Chr10:52032620..52032707 No primer for this exon
downstream ENSMUSE00000098836 Chr10:52034161..52034210 No primer for this exon
downstream ENSMUSE00000098834 Chr10:52036838..52036957 No primer for this exon
downstream ENSMUSE00000447452 Chr10:52039282..52040081 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr10:52031297..52031317 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGGTAAGGATGGTGCTTT Chr10:52031244..52031264 59.05 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019891