Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27356
Trapped Gene
OTTMUSG00000016574 (ENSMUSG00000078865)
Vector Insertion
Chr 2: 177356200 - 177356391
Public Clones not available
Private Clones OST62130 (lexicon) OST55266 (lexicon) OST53631 (lexicon) OST49484 (lexicon)
OST46355 (lexicon) OST44720 (lexicon) OST43773 (lexicon) OST43651 (lexicon)
OST42798 (lexicon) OST42796 (lexicon) OST42775 (lexicon) OST42570 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678581 (Chr2:177356392..177356518 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTTTGCTGGATCCTTCTC Chr2:177356449..177356468 61.24 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678581 (Chr2:177356392..177356518 -)
Downstram Exon
ENSMUSE00000678580 (Chr2:177356139..177356199 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTTTGCTGGATCCTTCTC Chr2:177356449..177356468 61.24 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678577 Chr2:177362835..177362915 AATGTGTTTTGAGCGCCTCT Chr2:177362881..177362900 59.88 45
upstream ENSMUSE00000678582 Chr2:177362835..177362904 AATGTGTTTTGAGCGCCTCT Chr2:177362881..177362900 59.88 45
upstream ENSMUSE00000709929 Chr2:177359674..177359728 No primer for this exon
upstream ENSMUSE00000678581 Chr2:177356392..177356518 GGCTTTGCTGGATCCTTCTC Chr2:177356449..177356468 61.24 55

*** Putative Vector Insertion (Chr 2: 177356200 - 177356391) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678580 Chr2:177356139..177356199 No primer for this exon
downstream ENSMUSE00000678575 Chr2:177355932..177356199 No primer for this exon
downstream ENSMUSE00000711203 Chr2:177353909..177354998 AAGGTCACTCCTTCCTGCAA Chr2:177353890..177353909 59.84 50
downstream ENSMUSE00000718806 Chr2:177353909..177354998 AAGGTCACTCCTTCCTGCAA Chr2:177353890..177353909 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:177356320..177356340 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000078865