Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27378
Trapped Gene
Gsn (ENSMUSG00000026879)
Vector Insertion
Chr 2: 35111994 - 35122339
Public Clones not available
Private Clones OST61262 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693955 (Chr2:35111950..35111993 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693955 (Chr2:35111950..35111993 +)
Downstram Exon
ENSMUSE00000693953 (Chr2:35122340..35122423 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGCTGAAGCACTGGAAGAGA Chr2:35122374..35122393 60.68 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693955 Chr2:35111950..35111993 No primer for this exon

*** Putative Vector Insertion (Chr 2: 35111994 - 35122339) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693953 Chr2:35122340..35122423 GGCTGAAGCACTGGAAGAGA Chr2:35122374..35122393 60.68 55
downstream ENSMUSE00000375062 Chr2:35137984..35138121 CAGAGCAGTGAAGAGCGGTA Chr2:35138015..35138034 59.34 55
downstream ENSMUSE00000376004 Chr2:35139425..35139629 AACTTCTCCACACGCCAGAT Chr2:35139510..35139529 59.73 50
downstream ENSMUSE00000693949 Chr2:35139425..35139629 AACTTCTCCACACGCCAGAT Chr2:35139510..35139529 59.73 50
downstream ENSMUSE00000163817 Chr2:35140194..35140348 CTGAACCTCACGGTGCTGTA Chr2:35140297..35140316 59.9 55
downstream ENSMUSE00000163832 Chr2:35145853..35146014 CTCTGGACCACCACCTCATT Chr2:35145914..35145933 59.96 55
downstream ENSMUSE00000163828 Chr2:35148107..35148256 CCAGAGCCACACCACTGATA Chr2:35148135..35148154 59.7 55
downstream ENSMUSE00000258353 Chr2:35148998..35149087 CTCGGTACCTTCAGGCAGAG Chr2:35149039..35149058 60.01 60
downstream ENSMUSE00000258344 Chr2:35150455..35150587 GGGGTTCTCATCAGCCACTA Chr2:35150511..35150530 60.07 55
downstream ENSMUSE00000258337 Chr2:35151645..35151733 CTGGGGTACTGCATCTTGGA Chr2:35151726..35151745 61.06 55
downstream ENSMUSE00000163822 Chr2:35151886..35152101 CGTAGCAGCATCGAAAGGTA Chr2:35152038..35152057 59.09 50
downstream ENSMUSE00000163826 Chr2:35154315..35154448 TGTAGCTGTCGCCTCCATAG Chr2:35154396..35154415 59.05 55
downstream ENSMUSE00000163818 Chr2:35156986..35157076 ACAGGAGTTCCTCCCAGCTC Chr2:35157075..35157094 60.79 60
downstream ENSMUSE00000163831 Chr2:35158011..35158181 ATGAGGTGTGCAGGCTCTTT Chr2:35158051..35158070 59.87 50
downstream ENSMUSE00000163825 Chr2:35158688..35158862 AAGGCATCGTTGGAGTTCAG Chr2:35158731..35158750 60.26 50
downstream ENSMUSE00000163823 Chr2:35159784..35159908 CAAAGAGTCGAGGAGGATGG Chr2:35159882..35159901 59.8 55
downstream ENSMUSE00000163820 Chr2:35160101..35160178 ATAAGCTCGCCAGGAACCTC Chr2:35160129..35160148 60.73 55
downstream ENSMUSE00000163824 Chr2:35162066..35162126 AAGGCTTCCGTCTTTTCCTC Chr2:35162121..35162140 59.83 50
downstream ENSMUSE00000357445 Chr2:35163017..35163417 TTGCTGGATCTGTCTCGATG Chr2:35163049..35163068 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTGTTGCTAGAGGCCCTGA Chr2:35117969..35117989 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTGTTGCTAGAGGCCCTGA Chr2:35117969..35117989 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026879