Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27379
Trapped Gene
Ate1 (ENSMUSG00000030850)
Vector Insertion
Chr 7: 137652773 - 137654324
Public Clones IST12819C2 (tigm)
Private Clones OST61199 (lexicon) OST59700 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000304983 (Chr7:137654325..137654428 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000304983 (Chr7:137654325..137654428 -)
Downstram Exon
ENSMUSE00000304975 (Chr7:137652521..137652772 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ATGCAAAGTCACCGTCAACA Chr7:137652700..137652719 60.16 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000587759 Chr7:137663391..137663475 CTGAAGGCCGGCTACTACTG Chr7:137663429..137663448 60.03 60
upstream ENSMUSE00000423413 Chr7:137662870..137663053 AAGAACAAGTTGGGCAGTCG Chr7:137662878..137662897 60.29 50
upstream ENSMUSE00000204315 Chr7:137659619..137659682 TTCCATGACAGTGCAGGATT Chr7:137659650..137659669 59.09 45
upstream ENSMUSE00000204314 Chr7:137657276..137657338 TGTCATGGATCAAACATGCTG Chr7:137657294..137657314 60.53 42.86
upstream ENSMUSE00000304983 Chr7:137654325..137654428 No primer for this exon

*** Putative Vector Insertion (Chr 7: 137652773 - 137654324) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000304975 Chr7:137652521..137652772 ATGCAAAGTCACCGTCAACA Chr7:137652700..137652719 60.16 45
downstream ENSMUSE00000368332 Chr7:137650996..137651213 TTTCCGACATGGAGGCTTAC Chr7:137651154..137651173 60.07 50
downstream ENSMUSE00000204317 Chr7:137648208..137648336 CTCACGGTTGGCTTATCAGG Chr7:137648190..137648209 60.65 55
downstream ENSMUSE00000304959 Chr7:137647236..137647364 GTCCTCAAAGGAGGCAGGTA Chr7:137647313..137647332 59.28 55
downstream ENSMUSE00000204319 Chr7:137625197..137625229 ATGGTGAGCTGCAAAGGAAT Chr7:137625180..137625199 59.7 45
downstream ENSMUSE00000204324 Chr7:137610770..137610951 ATGTCTAACACCCCCACAGC Chr7:137610832..137610851 59.85 55
downstream ENSMUSE00000204318 Chr7:137607645..137607744 GTTGCGATGTTTTCTCATGC Chr7:137607679..137607698 59.28 45
downstream ENSMUSE00000204316 Chr7:137561962..137562082 TGAAACGGCAGTACTTGGAG Chr7:137561958..137561977 58.92 50
downstream ENSMUSE00000668997 Chr7:137535040..137538250 CCTGGACAGACACCCAAAGT Chr7:137537282..137537301 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGAGATCTCGAAAGGCAAT Chr7:137654330..137654351 59.8 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGAGATCTCGAAAGGCAAT Chr7:137654330..137654351 59.8 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCAGCCATCAAAATCTCACAA Chr7:137654388..137654409 59.26 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCAGCCATCAAAATCTCACAA Chr7:137654388..137654409 59.26 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030850