Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27416
Trapped Gene
Slc25a30 (ENSMUSG00000022003)
Vector Insertion
Chr 14: 76174950 - 76176802
Public Clones not available
Private Clones OST60166 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000275801 (Chr14:76176803..76176933 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGTCAGCCCTCAACTGGAA Chr14:76176847..76176866 60.66 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000275801 (Chr14:76176803..76176933 -)
Downstram Exon
ENSMUSE00000122869 (Chr14:76174802..76174949 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGTCAGCCCTCAACTGGAA Chr14:76176847..76176866 60.66 50 TTCTTCTCGGCCTATCCTCA Chr14:76174803..76174822 59.91 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000275811 Chr14:76186732..76186841 GCTCCGAGGAGTAGCAGGAG Chr14:76186747..76186766 61.59 65
upstream ENSMUSE00000275801 Chr14:76176803..76176933 ATGTCAGCCCTCAACTGGAA Chr14:76176847..76176866 60.66 50

*** Putative Vector Insertion (Chr 14: 76174950 - 76176802) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000122869 Chr14:76174802..76174949 TTCTTCTCGGCCTATCCTCA Chr14:76174803..76174822 59.91 50
downstream ENSMUSE00000122865 Chr14:76171246..76171340 GTTCCACAGCTAACCGCTTC Chr14:76171233..76171252 59.88 55
downstream ENSMUSE00000275770 Chr14:76169978..76170063 ACATTGACCAGCAGGGTTTC Chr14:76170020..76170039 59.97 50
downstream ENSMUSE00000275762 Chr14:76169373..76169468 CCTCCTGCTGGTAAATGCTC Chr14:76169371..76169390 59.84 55
downstream ENSMUSE00000122871 Chr14:76168623..76168747 TCAGGTGCTTCTTGGTGATG Chr14:76168644..76168663 59.83 50
downstream ENSMUSE00000122864 Chr14:76166710..76166848 GTACCCTTATAGCCCGCACA Chr14:76166707..76166726 59.98 55
downstream ENSMUSE00000122867 Chr14:76163136..76163216 No primer for this exon
downstream ENSMUSE00000275734 Chr14:76160878..76162497 CAGCCGCCTCTGTAGTTTTC Chr14:76161765..76161784 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACAGCAGAATGCGGTAAGA Chr14:76176795..76176815 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAGCAGAATGCGGTAAGA Chr14:76176795..76176815 60.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022003