Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27419
Trapped Gene
Chchd7 (ENSMUSG00000042198)
Vector Insertion
Chr 4: 3868459 - 3869867
Public Clones not available
Private Clones OST60074 (lexicon) OST54205 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720042 (Chr4:3868393..3868458 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGCTGAGAGATCCTGACAT Chr4:3868423..3868442 60.37 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720042 (Chr4:3868393..3868458 +)
Downstram Exon
ENSMUSE00000268620 (Chr4:3869868..3869966 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGCTGAGAGATCCTGACAT Chr4:3868423..3868442 60.37 55 GCCGGCAGTTTTTGTACTTC Chr4:3869961..3869980 59.75 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676570 Chr4:3866035..3866109 ACTGACGTGTTTGGAACTGC Chr4:3866055..3866074 58.78 50
upstream ENSMUSE00000426421 Chr4:3866061..3866278 GAGGGCAGACCCTAGTTCGT Chr4:3866167..3866186 60.65 60
upstream ENSMUSE00000711285 Chr4:3866061..3866109 No primer for this exon
upstream ENSMUSE00000709941 Chr4:3866067..3866673 TCGTCTCCGACCTCTCAGAT Chr4:3866458..3866477 59.94 55
upstream ENSMUSE00000268633 Chr4:3866526..3866673 GTTCAGTAACGTGCCCTTCC Chr4:3866605..3866624 59.6 55
upstream ENSMUSE00000718665 Chr4:3866571..3866673 GTTCAGTAACGTGCCCTTCC Chr4:3866605..3866624 59.6 55
upstream ENSMUSE00000717048 Chr4:3868001..3868458 TACTTGTGGGGCTGATGACA Chr4:3868325..3868344 60.11 50
upstream ENSMUSE00000268625 Chr4:3868393..3868458 CGGCTGAGAGATCCTGACAT Chr4:3868423..3868442 60.37 55
upstream ENSMUSE00000720042 Chr4:3868393..3868458 CGGCTGAGAGATCCTGACAT Chr4:3868423..3868442 60.37 55

*** Putative Vector Insertion (Chr 4: 3868459 - 3869867) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000268620 Chr4:3869868..3869966 GCCGGCAGTTTTTGTACTTC Chr4:3869961..3869980 59.75 50
downstream ENSMUSE00000708775 Chr4:3869868..3870197 GCCGGCAGTTTTTGTACTTC Chr4:3869961..3869980 59.75 50
downstream ENSMUSE00000711150 Chr4:3870135..3870173 No primer for this exon
downstream ENSMUSE00000268615 Chr4:3870535..3870670 TGCTCCCAAAATTTCGTCTC Chr4:3870621..3870640 60.19 45
downstream ENSMUSE00000708331 Chr4:3870535..3870675 TGCTCCCAAAATTTCGTCTC Chr4:3870621..3870640 60.19 45
downstream ENSMUSE00000710682 Chr4:3870535..3870668 TGCTCCCAAAATTTCGTCTC Chr4:3870621..3870640 60.19 45
downstream ENSMUSE00000712183 Chr4:3870535..3870672 TGCTCCCAAAATTTCGTCTC Chr4:3870621..3870640 60.19 45
downstream ENSMUSE00000717365 Chr4:3870535..3870675 TGCTCCCAAAATTTCGTCTC Chr4:3870621..3870640 60.19 45
downstream ENSMUSE00000722017 Chr4:3870535..3870651 TGCTCCCAAAATTTCGTCTC Chr4:3870621..3870640 60.19 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr4:3868509..3868529 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCAACGTGACTGGGAAAA Chr4:3868504..3868524 60.39 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042198