Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2742
Trapped Gene
D14Ertd436e (ENSMUSG00000037526)
Vector Insertion
Chr 14: 48167034 - 48168593
Public Clones AK0281 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000312312 (Chr14:48168594..48168823 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGTGGATTAGCCTACCAAA Chr14:48168656..48168675 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000312312 (Chr14:48168594..48168823 -)
Downstram Exon
ENSMUSE00000312305 (Chr14:48166916..48167033 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGTGGATTAGCCTACCAAA Chr14:48168656..48168675 59.95 50 GTGTAGGCGGGGTTGTTATG Chr14:48166984..48167003 60.25 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000373419 Chr14:48187861..48188089 CCTTTACGTGGCTGTTGAGC Chr14:48187958..48187977 60.83 55
upstream ENSMUSE00000382522 Chr14:48180296..48180358 No primer for this exon
upstream ENSMUSE00000342057 Chr14:48178849..48178891 GGAAAGCGGCTTACAGATCA Chr14:48178853..48178872 60.35 50
upstream ENSMUSE00000374912 Chr14:48174235..48174316 TGTCATGCAAGATGAGGATTG Chr14:48174283..48174303 59.66 42.86
upstream ENSMUSE00000312318 Chr14:48170923..48171160 AGAAGATTCAGCGGCACAAC Chr14:48171063..48171082 60.41 50
upstream ENSMUSE00000312312 Chr14:48168594..48168823 CCGTGGATTAGCCTACCAAA Chr14:48168656..48168675 59.95 50

*** Putative Vector Insertion (Chr 14: 48167034 - 48168593) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000312305 Chr14:48166916..48167033 GTGTAGGCGGGGTTGTTATG Chr14:48166984..48167003 60.25 55
downstream ENSMUSE00000312298 Chr14:48165466..48165556 GAGGTTTTCGCCACAGAACT Chr14:48165513..48165532 59.33 50
downstream ENSMUSE00000312288 Chr14:48165303..48165388 TGACCAAGTGCATCAGGTTC Chr14:48165306..48165325 59.68 50
downstream ENSMUSE00000370303 Chr14:48160569..48162818 TCATCGCTTACACGCTCATC Chr14:48162689..48162708 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGACCTGGTGAGAAGCAA Chr14:48168581..48168601 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGACCTGGTGAGAAGCAA Chr14:48168581..48168601 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037526