Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27431
Trapped Gene
A630033E08Rik (ENSMUSG00000059142)
Vector Insertion
Chr 17: 23002304 - 23003947
Public Clones (sanger) (sanger) (ggtc)
Private Clones OST59589 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000392620 (Chr17:23003948..23004071 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGTACCCGAAAACTTCCTT Chr17:23004012..23004031 59.33 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000392620 (Chr17:23003948..23004071 -)
Downstram Exon
ENSMUSE00000713356 (Chr17:23002214..23002303 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGTACCCGAAAACTTCCTT Chr17:23004012..23004031 59.33 50 CTCTTCACCATCCAGGGTTC Chr17:23002218..23002237 59.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000392620 Chr17:23003948..23004071 GGGTACCCGAAAACTTCCTT Chr17:23004012..23004031 59.33 50

*** Putative Vector Insertion (Chr 17: 23002304 - 23003947) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000713356 Chr17:23002214..23002303 CTCTTCACCATCCAGGGTTC Chr17:23002218..23002237 59.51 55
downstream ENSMUSE00000721074 Chr17:23002214..23002303 CTCTTCACCATCCAGGGTTC Chr17:23002218..23002237 59.51 55
downstream ENSMUSE00000613023 Chr17:22998699..22998819 TGTGGCGCGAAACACTATTA Chr17:22998712..22998731 60.27 45
downstream ENSMUSE00000613022 Chr17:22998473..22998528 CTGGGGAGCATTTACCAAAG Chr17:22998451..22998470 59.56 50
downstream ENSMUSE00000613026 Chr17:22998473..22998528 CTGGGGAGCATTTACCAAAG Chr17:22998451..22998470 59.56 50
downstream ENSMUSE00000553921 Chr17:22994217..22994343 TGTACAATGCCCTCTGAGCA Chr17:22994237..22994256 60.41 50
downstream ENSMUSE00000552707 Chr17:22985997..22989733 TTTCTCCGGCATGAATTCTC Chr17:22988071..22988090 60.15 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTTTGGAAGCGTCAGCAG Chr17:23003968..23003988 61.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTTTGGAAGCGTCAGCAG Chr17:23003968..23003988 61.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCCACCTTTCCCTGAAGAAC Chr17:23004083..23004103 59.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000059142