Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27501
Trapped Gene
Actn2 (ENSMUSG00000052374)
Vector Insertion
Chr 13: 12401254 - 12401861
Public Clones IST10922H2 (tigm) IST10986G6 (tigm) IST13640H3 (tigm) IST11081D3 (tigm)
IST10345A11 (tigm) IST10259D10 (tigm) IST10259D10 (tigm) IST11064F9 (tigm)
IST12504A4 (tigm) IST10986G6 (tigm) IST11459F9 (tigm) IST11369E10 (tigm)
IST11081D3 (tigm) IST12100B4 (tigm)
Private Clones OST57986 (lexicon)
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000571896 (Chr13:12401862..12401981 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCACAAGATTGCGAATGTC Chr13:12401923..12401942 59.65 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000571896 (Chr13:12401862..12401981 -)
Downstram Exon
ENSMUSE00000684611 (Chr13:12400486..12401253 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCACAAGATTGCGAATGTC Chr13:12401923..12401942 59.65 45 TAGCACTGCCTCGGTCTTTT Chr13:12400973..12400992 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000342528 Chr13:12432642..12432999 CGGCGTGCAGTACAACTATG Chr13:12432731..12432750 60.34 55
upstream ENSMUSE00000711006 Chr13:12432642..12432999 CGGCGTGCAGTACAACTATG Chr13:12432731..12432750 60.34 55
upstream ENSMUSE00000571897 Chr13:12403114..12403228 GCACCCAGATCGAGAACATC Chr13:12403169..12403188 60.63 55
upstream ENSMUSE00000571896 Chr13:12401862..12401981 TCCACAAGATTGCGAATGTC Chr13:12401923..12401942 59.65 45

*** Putative Vector Insertion (Chr 13: 12401254 - 12401861) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000571895 Chr13:12401167..12401253 TCTTCACATTGCCATCGACT Chr13:12401208..12401227 59.24 45
downstream ENSMUSE00000684611 Chr13:12400486..12401253 TAGCACTGCCTCGGTCTTTT Chr13:12400973..12400992 60.01 50
downstream ENSMUSE00000571894 Chr13:12398541..12398628 CCTCTGACACCATAGCAGCA Chr13:12398566..12398585 60.01 55
downstream ENSMUSE00000571893 Chr13:12396581..12396659 ATGAGGGCACAGAGTCCAAG Chr13:12396605..12396624 60.26 55
downstream ENSMUSE00000571892 Chr13:12393202..12393283 TCCATGGCCAGGTTAATGTT Chr13:12393227..12393246 60.19 45
downstream ENSMUSE00000571891 Chr13:12388742..12388827 CTTTCATCGGGTTTGGGAGT Chr13:12388775..12388794 61.24 50
downstream ENSMUSE00000298103 Chr13:12386577..12386669 TTCCATCAGCCTCTCATTCTC Chr13:12386579..12386599 59.38 47.62
downstream ENSMUSE00000571890 Chr13:12383927..12384157 CTTCTCAGGCGTCCTGTTCT Chr13:12384079..12384098 59.6 55
downstream ENSMUSE00000114863 Chr13:12382941..12383088 CGCTCCAGTCTTCGAATCTC Chr13:12382981..12383000 60.1 55
downstream ENSMUSE00000571889 Chr13:12380774..12380924 CGCAGACTCGTAGTCCTTCTG Chr13:12380862..12380882 60.2 57.14
downstream ENSMUSE00000116667 Chr13:12374782..12374890 CACCGATCATTGACGTTCAC Chr13:12374827..12374846 59.97 50
downstream ENSMUSE00000571888 Chr13:12372696..12372836 ATCTCCTCGATGCTGTGGAC Chr13:12372678..12372697 60.23 55
downstream ENSMUSE00000298063 Chr13:12371061..12371243 ACAGTGCTGTAGGGGTTGCT Chr13:12371073..12371092 59.79 55
downstream ENSMUSE00000298054 Chr13:12369666..12369800 GACGCTCATTAGCATGTTGG Chr13:12369706..12369725 59.3 50
downstream ENSMUSE00000571887 Chr13:12368630..12368809 CCATGGTGTAGTTCGTGTGC Chr13:12368610..12368629 60.03 55
downstream ENSMUSE00000571886 Chr13:12367345..12367491 TGGGTCTCCACCTCATTGAT Chr13:12367402..12367421 60.33 50
downstream ENSMUSE00000116672 Chr13:12364966..12365031 CATAGCCCATGGAAATGAGG Chr13:12364949..12364968 60.29 50
downstream ENSMUSE00000571885 Chr13:12363045..12363203 TTGGGGTCAACCAAAGTCAT Chr13:12363138..12363157 60.21 45
downstream ENSMUSE00000406318 Chr13:12361696..12361919 CTCTCGACGAAGCTCCTCTG Chr13:12361865..12361884 60.42 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAAGGGAGTGAAGCTGGTA Chr13:12401876..12401896 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAAGGGAGTGAAGCTGGTA Chr13:12401876..12401896 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAAAAATGCGGTTCCACAAG Chr13:12401933..12401953 60.48 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAAAAATGCGGTTCCACAAG Chr13:12401933..12401953 60.48 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052374