Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27510
Trapped Gene
Zfp592 (ENSMUSG00000005621)
Vector Insertion
Chr 7: 88138649 - 88154319
Public Clones IST14431A5 (tigm) IST14958E10 (tigm)
Private Clones OST57827 (lexicon) OST54224 (lexicon) OST43733 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672825 (Chr7:88138598..88138648 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672825 (Chr7:88138598..88138648 +)
Downstram Exon
ENSMUSE00000633904 (Chr7:88154320..88154425 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672819 Chr7:88138570..88138648 No primer for this exon
upstream ENSMUSE00000672825 Chr7:88138598..88138648 No primer for this exon

*** Putative Vector Insertion (Chr 7: 88138649 - 88154319) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000633904 Chr7:88154320..88154425 No primer for this exon
downstream ENSMUSE00000313250 Chr7:88168157..88170395 No primer for this exon
downstream ENSMUSE00000711051 Chr7:88168157..88170395 No primer for this exon
downstream ENSMUSE00000152596 Chr7:88174335..88174513 No primer for this exon
downstream ENSMUSE00000152590 Chr7:88182236..88182412 No primer for this exon
downstream ENSMUSE00000152595 Chr7:88182691..88182850 No primer for this exon
downstream ENSMUSE00000152593 Chr7:88182950..88183237 No primer for this exon
downstream ENSMUSE00000152592 Chr7:88183439..88183551 No primer for this exon
downstream ENSMUSE00000152594 Chr7:88184016..88184151 No primer for this exon
downstream ENSMUSE00000384796 Chr7:88186234..88187581 No primer for this exon
downstream ENSMUSE00000672820 Chr7:88186234..88190050 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTAATCGCCTTGCAGCACA Chr7:88138698..88138718 62.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCCAAGTGATTCCCTGTC Chr7:88138657..88138677 59.66 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005621