Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27521
Trapped Gene
Zfp330 (ENSMUSG00000031711)
Vector Insertion
Chr 8: 85290673 - 85291111
Public Clones not available
Private Clones OST57637 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212284 (Chr8:85291112..85291238 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATGTGAGCGAGGGGTATG Chr8:85291120..85291139 60.48 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212284 (Chr8:85291112..85291238 -)
Downstram Exon
ENSMUSE00000212287 (Chr8:85290568..85290672 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATGTGAGCGAGGGGTATG Chr8:85291120..85291139 60.48 55 GGCAAAACGAACAGCTGAAT Chr8:85290621..85290640 60.26 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581568 Chr8:85297956..85298059 CTGCTTCTGCCGTTCTAGCC Chr8:85297994..85298013 62.48 60
upstream ENSMUSE00000400309 Chr8:85296779..85296910 GAAACAACTGCGAGCATCAA Chr8:85296823..85296842 59.99 45
upstream ENSMUSE00000212286 Chr8:85295238..85295257 No primer for this exon
upstream ENSMUSE00000212288 Chr8:85294700..85294770 GCGGCAGAAGAATAGAGCAT Chr8:85294751..85294770 59.58 50
upstream ENSMUSE00000212283 Chr8:85293219..85293298 No primer for this exon
upstream ENSMUSE00000212284 Chr8:85291112..85291238 GAATGTGAGCGAGGGGTATG Chr8:85291120..85291139 60.48 55

*** Putative Vector Insertion (Chr 8: 85290673 - 85291111) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212287 Chr8:85290568..85290672 GGCAAAACGAACAGCTGAAT Chr8:85290621..85290640 60.26 45
downstream ENSMUSE00000212292 Chr8:85289911..85289957 CAAGTCGATTGCAGGAAACA Chr8:85289915..85289934 59.84 45
downstream ENSMUSE00000212291 Chr8:85288754..85288871 GGCAAGGAGGTTGTTTTCCT Chr8:85288780..85288799 60.48 50
downstream ENSMUSE00000541833 Chr8:85288163..85288390 ACTTGTCCGACGACAGGTTC Chr8:85288276..85288295 60.16 55
downstream ENSMUSE00000681789 Chr8:85287991..85288010 No primer for this exon
downstream ENSMUSE00000412168 Chr8:85287520..85288390 CAACCGCTAATGCAGAGTGA Chr8:85287660..85287679 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCATGGTGAGTGATGAGGTG Chr8:85291095..85291115 59.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGGTGAGTGATGAGGTG Chr8:85291095..85291115 59.95 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031711