Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27534
Trapped Gene
Tdrd3 (ENSMUSG00000022019)
Vector Insertion
Chr 14: 87858630 - 87871882
Public Clones IST10409H6 (tigm) IST10432B12 (tigm) IST10379A11 (tigm) IST10421H8 (tigm)
IST10367C7 (tigm) IST10373C11 (tigm) IST10420F9 (tigm) IST10370H1 (tigm)
IST10374H2 (tigm) IST10376A8 (tigm) IST10411G12 (tigm) IST10410F8 (tigm)
IST10420A9 (tigm) IST10381F1 (tigm) IST10377A10 (tigm) IST10424A10 (tigm)
IST10420F10 (tigm) IST10371G1 (tigm)
Private Clones OST57340 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000612788 (Chr14:87858564..87858629 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACATCAACGGTGGAAAGGT Chr14:87858603..87858622 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000612788 (Chr14:87858564..87858629 +)
Downstram Exon
ENSMUSE00000488064 (Chr14:87871883..87872043 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACATCAACGGTGGAAAGGT Chr14:87858603..87858622 59.83 50 GCTTGCGATTCCTCGTTATC Chr14:87871962..87871981 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000612790 Chr14:87816489..87816655 CGAGCCTGAACAGCTAACCA Chr14:87816596..87816615 61.5 55
upstream ENSMUSE00000612789 Chr14:87856841..87856925 TTTCAGATGAAGGCGTTGAA Chr14:87856846..87856865 59.4 40
upstream ENSMUSE00000612788 Chr14:87858564..87858629 GACATCAACGGTGGAAAGGT Chr14:87858603..87858622 59.83 50

*** Putative Vector Insertion (Chr 14: 87858630 - 87871882) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000488064 Chr14:87871883..87872043 GCTTGCGATTCCTCGTTATC Chr14:87871962..87871981 59.81 50
downstream ENSMUSE00000553911 Chr14:87874506..87874647 TGTTCCACTTCACCACCAAG Chr14:87874622..87874641 59.56 50
downstream ENSMUSE00000122963 Chr14:87877197..87877268 TGCCCAAAAGGTAGAAAAGG Chr14:87877270..87877289 59.2 45
downstream ENSMUSE00000122960 Chr14:87880541..87880690 AATGGCAGCAGTTCTTTGCT Chr14:87880669..87880688 60.02 45
downstream ENSMUSE00000122962 Chr14:87885366..87885506 CTCCCTATTTCGGTGACCAG Chr14:87885446..87885465 59.54 55
downstream ENSMUSE00000122955 Chr14:87885999..87886155 TGTTGGCATTATCCATCAGC Chr14:87886086..87886105 59.5 45
downstream ENSMUSE00000122958 Chr14:87886969..87887094 GGTTCCCAGGTCTTCCTCAT Chr14:87887027..87887046 60.31 55
downstream ENSMUSE00000284834 Chr14:87905566..87906413 CATTGTCCGTGGTTTCCTCT Chr14:87906089..87906108 59.97 50
downstream ENSMUSE00000284824 Chr14:87911452..87911577 CGCTGTCATACCCGAAGAAT Chr14:87911502..87911521 60.1 50
downstream ENSMUSE00000388834 Chr14:87939204..87939328 TTGGTAAAACTGCTGCGTTG Chr14:87939302..87939321 59.91 45
downstream ENSMUSE00000612787 Chr14:87945064..87945307 CCCCATTGCCTTGTGTAAAT Chr14:87945228..87945247 59.69 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGCTGTTAATCGCCTTGC Chr14:87858673..87858693 60.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGAGCAGTGAGGTGATGC Chr14:87858631..87858651 60.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022019