Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2754
Trapped Gene
Ptpn23 (ENSMUSG00000036057)
Vector Insertion
Chr 9: 110300700 - 110310537
Public Clones AK0174 (sanger) D175C12 (ggtc) (ggtc) D071F06 (ggtc) D175C12 (ggtc)
IST14113E9 (tigm)
Private Clones OST458838 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000583195 (Chr9:110310538..110310714 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTCCAGTCTGCGGTGAAG Chr9:110310541..110310560 60.44 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000583195 (Chr9:110310538..110310714 -)
Downstram Exon
ENSMUSE00000583194 (Chr9:110300625..110300699 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTCCAGTCTGCGGTGAAG Chr9:110310541..110310560 60.44 55 TCCTCGTTGTAGGCTTCTGG Chr9:110300631..110300650 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583195 Chr9:110310538..110310714 ACTTCCAGTCTGCGGTGAAG Chr9:110310541..110310560 60.44 55

*** Putative Vector Insertion (Chr 9: 110300700 - 110310537) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583194 Chr9:110300625..110300699 TCCTCGTTGTAGGCTTCTGG Chr9:110300631..110300650 60.39 55
downstream ENSMUSE00000583193 Chr9:110296205..110296332 GGTAGTGTAGCTGGCCAAGG Chr9:110296238..110296257 59.76 60
downstream ENSMUSE00000583192 Chr9:110295875..110295951 TTGCCCGAGAAGATCTCAGT Chr9:110295909..110295928 59.95 50
downstream ENSMUSE00000583191 Chr9:110295207..110295256 AGACACCCGCTTGTCCATAG Chr9:110295191..110295210 60.13 55
downstream ENSMUSE00000583190 Chr9:110294989..110295120 AGGATCTGGCGACTCATGTC Chr9:110294992..110295011 60.23 55
downstream ENSMUSE00000583189 Chr9:110294486..110294566 CTCTTCCGGTTGTCCAACAT Chr9:110294492..110294511 59.97 50
downstream ENSMUSE00000583188 Chr9:110294271..110294402 GGCAGTATCAGGGTTTTCCA Chr9:110294327..110294346 59.93 50
downstream ENSMUSE00000583187 Chr9:110294138..110294185 CGTTCCCCAAATTTCTGTTG Chr9:110294117..110294136 60.34 45
downstream ENSMUSE00000583186 Chr9:110293713..110293769 CCAGGGCACTCTGGAAGTAG Chr9:110293723..110293742 59.86 60
downstream ENSMUSE00000583185 Chr9:110293548..110293606 CGAAGTGCATCTTGCACAGT Chr9:110293553..110293572 60.06 50
downstream ENSMUSE00000583184 Chr9:110293355..110293434 GGCACAGCCTCATGGTAGAT Chr9:110293362..110293381 60.1 55
downstream ENSMUSE00000583183 Chr9:110293134..110293248 GTTTACTGGCAAGGGCTTCA Chr9:110293195..110293214 60.25 50
downstream ENSMUSE00000583182 Chr9:110292974..110293039 AAGCAGTTTGGCCTTCTCCT Chr9:110292996..110293015 60.38 50
downstream ENSMUSE00000529295 Chr9:110292547..110292692 TTGTAGGCATCCAAGTTGTCC Chr9:110292611..110292631 59.99 47.62
downstream ENSMUSE00000529294 Chr9:110291977..110292294 TTCATAGCACGATGCAGCTC Chr9:110292038..110292057 60.13 50
downstream ENSMUSE00000529293 Chr9:110291745..110291899 ATGCGCTTTAGGTTTTGCAG Chr9:110291844..110291863 60.4 45
downstream ENSMUSE00000529292 Chr9:110291516..110291667 TTGGTCCAGCTCACTAAGCA Chr9:110291496..110291515 59.59 50
downstream ENSMUSE00000529291 Chr9:110291245..110291424 GCCTTCTTGGGACTTCTTCA Chr9:110291327..110291346 59.4 50
downstream ENSMUSE00000529290 Chr9:110289235..110291155 ACCACACGGTTGCTGTCATA Chr9:110289397..110289416 60.03 50
downstream ENSMUSE00000309333 Chr9:110288958..110289142 ATGGAGGTGCACAAGAGAGC Chr9:110288956..110288975 60.42 55
downstream ENSMUSE00000309312 Chr9:110288749..110288853 GGTCGCTGGTGCAAATAATG Chr9:110288757..110288776 61.42 50
downstream ENSMUSE00000309292 Chr9:110288522..110288660 TTTCCTGCAGCATGTGTTTC Chr9:110288502..110288521 59.85 45
downstream ENSMUSE00000309269 Chr9:110288318..110288431 CTCCACATGTCTCACCAACG Chr9:110288365..110288384 60.15 55
downstream ENSMUSE00000331626 Chr9:110287593..110288236 GCTAGCTGGTGGAAGACCTG Chr9:110288047..110288066 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGGTGACTTTCACTTCCAG Chr9:110310551..110310571 60.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCTGCGGTGAAGAAGGTG Chr9:110301533..110301553 60.44 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGTGTCTGGTGGCTTTTGA Chr9:110301696..110301716 59.73 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGTGTCTGGTGGCTTTTGA Chr9:110301696..110301716 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036057