Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27551
Trapped Gene
Atp13a2 (ENSMUSG00000036622)
Vector Insertion
Chr 4: 140542992 - 140548046
Public Clones not available
Private Clones OST57014 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000459651 (Chr4:140542809..140542991 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000459651 (Chr4:140542809..140542991 +)
Downstram Exon
ENSMUSE00000459641 (Chr4:140548047..140548141 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GATCGATTGACGTCCCTGTC Chr4:140548118..140548137 60.48 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459651 Chr4:140542809..140542991 No primer for this exon

*** Putative Vector Insertion (Chr 4: 140542992 - 140548046) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000459641 Chr4:140548047..140548141 GATCGATTGACGTCCCTGTC Chr4:140548118..140548137 60.48 55
downstream ENSMUSE00000375981 Chr4:140548253..140548435 CTCCATGGACTGCCACAGTA Chr4:140548287..140548306 59.7 55
downstream ENSMUSE00000363648 Chr4:140549711..140549769 ACCTGAACCGTGAAGAGCTG Chr4:140549745..140549764 60.44 55
downstream ENSMUSE00000405111 Chr4:140549863..140549977 CTGTGGAGTTCGGAGGTGTC Chr4:140549967..140549986 60.71 60
downstream ENSMUSE00000278170 Chr4:140550227..140550306 ATCCAGACGTAGCGTTGACC Chr4:140550279..140550298 60.14 55
downstream ENSMUSE00000278162 Chr4:140551241..140551318 AGCAGTGGACGTCATCACAG Chr4:140551284..140551303 59.9 55
downstream ENSMUSE00000335765 Chr4:140551473..140551542 CAGCAGCTGCAGGTAGGACT Chr4:140551536..140551555 60.75 60
downstream ENSMUSE00000278144 Chr4:140552217..140552351 CTGAAGGCTTGGAACCCATA Chr4:140552254..140552273 60.07 50
downstream ENSMUSE00000278132 Chr4:140552439..140552505 AGCTTGACCATGTCCCTCAA Chr4:140552473..140552492 60.66 50
downstream ENSMUSE00000278123 Chr4:140552583..140552714 GAGCTCTCGTTGACCACACA Chr4:140552709..140552728 60.03 55
downstream ENSMUSE00000278115 Chr4:140555043..140555198 TGTCCGAGTCACCACTGCTA Chr4:140555200..140555219 60.46 55
downstream ENSMUSE00000278107 Chr4:140556258..140556368 GCCACAAACTTCATGCTGTG Chr4:140556354..140556373 60.31 50
downstream ENSMUSE00000278100 Chr4:140556458..140556504 TGTAGACGGTGCCTAGCAGA Chr4:140556481..140556500 59.62 55
downstream ENSMUSE00000278092 Chr4:140556600..140556788 TCCAGAGCTCGGATCACAAT Chr4:140556637..140556656 60.77 50
downstream ENSMUSE00000407281 Chr4:140557799..140558005 CAGCCTGTAGACTCCACCATC Chr4:140558006..140558026 59.74 57.14
downstream ENSMUSE00000276064 Chr4:140558372..140558461 GGTGGGGGTCTCATTACCAC Chr4:140558445..140558464 61.41 60
downstream ENSMUSE00000276053 Chr4:140558539..140558698 TGGCCATGTCACTACCACAT Chr4:140558628..140558647 59.84 50
downstream ENSMUSE00000376571 Chr4:140558814..140558934 CAGCAGCTGTGTAGCTCTGC Chr4:140558861..140558880 60.1 60
downstream ENSMUSE00000350684 Chr4:140559066..140559190 AGTAGGTTCCGCATGACCAG Chr4:140559125..140559144 60.13 55
downstream ENSMUSE00000375267 Chr4:140559801..140559961 GTGACTGCTGTCTGCAGGTT Chr4:140559828..140559847 59.05 55
downstream ENSMUSE00000276018 Chr4:140560097..140560201 GAAGGACTGCAAACGTGGAC Chr4:140560175..140560194 60.7 55
downstream ENSMUSE00000276009 Chr4:140560283..140560362 TGCAGTTCGCACACTAGCTC Chr4:140560356..140560375 60.36 55
downstream ENSMUSE00000275994 Chr4:140560917..140561069 GGTGAACGGAGAGACCACTG Chr4:140561031..140561050 60.71 60
downstream ENSMUSE00000275984 Chr4:140561181..140561277 GGGCCATGTACTTGAAGACG Chr4:140561236..140561255 60.52 55
downstream ENSMUSE00000275974 Chr4:140561958..140562181 AGGGCTGAGCTATGACCAAA Chr4:140562183..140562202 59.84 50
downstream ENSMUSE00000275962 Chr4:140562267..140562418 TTCTCGTAGTTGGGCAGGTT Chr4:140562326..140562345 59.73 50
downstream ENSMUSE00000275951 Chr4:140562594..140562763 GAAGTTGAAGGCGACCAGAC Chr4:140562745..140562764 59.85 55
downstream ENSMUSE00000459368 Chr4:140562856..140563242 CAGCTCTGGATGGAGTTGGT Chr4:140563212..140563231 60.26 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTGCTGTTTCCTGGCTA Chr4:140545954..140545974 59.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTGCTGTTTCCTGGCTA Chr4:140545954..140545974 59.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036622